Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221209303:

Variant ID: vg0221209303 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21209303
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

TCTTGGTTTTGGCGTCGCTTTCTCCGCTCTTTGACATCTTGGTTGCAGGCACTTCTCCTTTGCTTGATATGGACGCAGCCAGTCGGATTTCTTCTCGGGC[G/A]
AGCGTGATCTCGCGGGTCTGGGCCATCTCGCAGCTTTCCTTGTCGCATGTGACGGCTTGCTTGATGTCACTCCACAGGGATATGACTCCTCGAGGACCAG

Reverse complement sequence

CTGGTCCTCGAGGAGTCATATCCCTGTGGAGTGACATCAAGCAAGCCGTCACATGCGACAAGGAAAGCTGCGAGATGGCCCAGACCCGCGAGATCACGCT[C/T]
GCCCGAGAAGAAATCCGACTGGCTGCGTCCATATCAAGCAAAGGAGAAGTGCCTGCAACCAAGATGTCAAAGAGCGGAGAAAGCGACGCCAAAACCAAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.40%	9.20%	0.25%	0.17%	NA
All Indica	2759	84.80%	14.40%	0.43%	0.29%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	95.00%	4.70%	0.17%	0.17%	NA
Indica II	465	86.70%	12.70%	0.43%	0.22%	NA
Indica III	913	75.40%	23.70%	0.66%	0.33%	NA
Indica Intermediate	786	87.20%	12.10%	0.38%	0.38%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	75.00%	25.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221209303	G -> A	LOC_Os02g35290.1	synonymous_variant ; p.Leu587Leu; LOW	synonymous_codon	Average:35.946; most accessible tissue: Zhenshan97 flag leaf, score: 53.034	N	N	N	N
vg0221209303	G -> DEL	LOC_Os02g35290.1	N	frameshift_variant	Average:35.946; most accessible tissue: Zhenshan97 flag leaf, score: 53.034	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221209303	NA	1.06E-07	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209303	NA	9.89E-08	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209303	NA	1.54E-08	mr1908	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209303	NA	6.21E-06	mr1908	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209303	1.89E-06	1.89E-06	mr1996	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209303	NA	4.11E-06	mr1160_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209303	NA	7.15E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209303	NA	1.15E-06	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221209303	NA	2.80E-06	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251