| Variant ID: vg0221025908 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21025908 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGTTTAATATTTCAAATATGTGTCAGTATATACGATGTAACACGCCAAAATTTTACACCTATGAATCTAAACACCCCCTTAGTGTGCGTGAAGATTCTGA[C/T]
GCCAAAGTTGTTCGGCGACCCCATCAATTGTGGTACTTAATATTGTGGTTAATATTGTGGTTTATACGAAGTTCTCGGTTTCAAAGCAGTAAGAAAATTT
AAATTTTCTTACTGCTTTGAAACCGAGAACTTCGTATAAACCACAATATTAACCACAATATTAAGTACCACAATTGATGGGGTCGCCGAACAACTTTGGC[G/A]
TCAGAATCTTCACGCACACTAAGGGGGTGTTTAGATTCATAGGTGTAAAATTTTGGCGTGTTACATCGTATATACTGACACATATTTGAAATATTAAACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.50% | 0.50% | 1.35% | 40.58% | NA |
| All Indica | 2759 | 39.30% | 0.70% | 1.34% | 58.68% | NA |
| All Japonica | 1512 | 94.10% | 0.10% | 0.13% | 5.69% | NA |
| Aus | 269 | 21.90% | 1.50% | 8.55% | 68.03% | NA |
| Indica I | 595 | 21.80% | 0.80% | 0.34% | 76.97% | NA |
| Indica II | 465 | 36.10% | 0.60% | 1.08% | 62.15% | NA |
| Indica III | 913 | 57.80% | 0.40% | 1.86% | 39.87% | NA |
| Indica Intermediate | 786 | 32.70% | 1.00% | 1.65% | 64.63% | NA |
| Temperate Japonica | 767 | 93.40% | 0.10% | 0.13% | 6.39% | NA |
| Tropical Japonica | 504 | 95.00% | 0.00% | 0.20% | 4.76% | NA |
| Japonica Intermediate | 241 | 94.60% | 0.00% | 0.00% | 5.39% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 67.80% | 0.00% | 1.11% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221025908 | C -> T | LOC_Os02g35039.1 | upstream_gene_variant ; 1821.0bp to feature; MODIFIER | silent_mutation | Average:36.163; most accessible tissue: Zhenshan97 flower, score: 69.437 | N | N | N | N |
| vg0221025908 | C -> T | LOC_Os02g35039.2 | upstream_gene_variant ; 1821.0bp to feature; MODIFIER | silent_mutation | Average:36.163; most accessible tissue: Zhenshan97 flower, score: 69.437 | N | N | N | N |
| vg0221025908 | C -> T | LOC_Os02g35020-LOC_Os02g35039 | intergenic_region ; MODIFIER | silent_mutation | Average:36.163; most accessible tissue: Zhenshan97 flower, score: 69.437 | N | N | N | N |
| vg0221025908 | C -> DEL | N | N | silent_mutation | Average:36.163; most accessible tissue: Zhenshan97 flower, score: 69.437 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221025908 | 3.00E-06 | NA | mr1095 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221025908 | 3.50E-07 | 3.50E-07 | mr1098 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221025908 | 1.05E-07 | 1.05E-07 | mr1099 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221025908 | 7.24E-12 | 5.76E-09 | mr1101 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221025908 | 5.01E-06 | 8.00E-06 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221025908 | 4.53E-07 | 3.19E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221025908 | 7.63E-09 | 1.40E-07 | mr1150 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221025908 | NA | 9.36E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221025908 | 2.09E-07 | 7.12E-06 | mr1242 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221025908 | 6.45E-07 | 1.38E-06 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/