Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221013727:

Variant ID: vg0221013727 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21013727
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACGGGGAGAGTATCTCTCAGCCTTTATTTCTATGTAGACTTGGTTAGTACCGTTGGAGGGGTTTAGACAATGAGGATGCTCTAAGTTTCATATAGAGTT[C/T]
GTTGTCATCTGATTTTATATGGAAGGGTGCGTTTTATTTTTTTTGAAATAGTAGTGCTCATATTTCTAAGGGTGGTTCATTAAGAGAATCGCCCATGAAA

Reverse complement sequence

TTTCATGGGCGATTCTCTTAATGAACCACCCTTAGAAATATGAGCACTACTATTTCAAAAAAAATAAAACGCACCCTTCCATATAAAATCAGATGACAAC[G/A]
AACTCTATATGAAACTTAGAGCATCCTCATTGTCTAAACCCCTCCAACGGTACTAACCAAGTCTACATAGAAATAAAGGCTGAGAGATACTCTCCCCGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.20% 1.80% 0.00% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 95.40% 4.60% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 94.40% 5.60% 0.00% 0.00% NA
Tropical Japonica  504 95.40% 4.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221013727 C -> T LOC_Os02g35020.1 downstream_gene_variant ; 720.0bp to feature; MODIFIER silent_mutation Average:41.558; most accessible tissue: Callus, score: 77.858 N N N N
vg0221013727 C -> T LOC_Os02g35010-LOC_Os02g35020 intergenic_region ; MODIFIER silent_mutation Average:41.558; most accessible tissue: Callus, score: 77.858 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221013727 NA 3.43E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221013727 1.91E-08 1.91E-08 mr1099 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221013727 7.96E-08 1.46E-09 mr1101 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221013727 NA 3.82E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221013727 1.75E-07 1.11E-07 mr1150 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221013727 NA 8.58E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221013727 5.25E-06 1.47E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221013727 1.02E-06 1.02E-06 mr1595 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221013727 NA 9.19E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221013727 NA 9.18E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221013727 3.77E-06 3.77E-06 mr1868 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221013727 NA 8.37E-08 mr1098_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221013727 NA 1.92E-06 mr1099_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221013727 NA 9.14E-07 mr1150_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251