| Variant ID: vg0220960199 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20960199 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGATATTTATCGATTCACCAGAAATTAAGTTTAAATTTGACATGCACCTTGAAAAAAAAAGATAAATTCGGGTATGGACACTACCACTACCCTATTATT[C/T]
ATATACCGAATTTATGTTTTTTATATATCAATGTGTAAGTTGAGTTTGGATCTTACATTTTTTTAGAGGTGGTATATGTATTTGTACGAACGCTGTCAAC
GTTGACAGCGTTCGTACAAATACATATACCACCTCTAAAAAAATGTAAGATCCAAACTCAACTTACACATTGATATATAAAAAACATAAATTCGGTATAT[G/A]
AATAATAGGGTAGTGGTAGTGTCCATACCCGAATTTATCTTTTTTTTTCAAGGTGCATGTCAAATTTAAACTTAATTTCTGGTGAATCGATAAATATCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.20% | 1.80% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 95.60% | 4.20% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.00% | 4.80% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 4.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220960199 | C -> T | LOC_Os02g34930.1 | downstream_gene_variant ; 3914.0bp to feature; MODIFIER | silent_mutation | Average:62.924; most accessible tissue: Callus, score: 84.176 | N | N | N | N |
| vg0220960199 | C -> T | LOC_Os02g34950.1 | downstream_gene_variant ; 2739.0bp to feature; MODIFIER | silent_mutation | Average:62.924; most accessible tissue: Callus, score: 84.176 | N | N | N | N |
| vg0220960199 | C -> T | LOC_Os02g34940.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.924; most accessible tissue: Callus, score: 84.176 | N | N | N | N |
| vg0220960199 | C -> T | LOC_Os02g34940.2 | intron_variant ; MODIFIER | silent_mutation | Average:62.924; most accessible tissue: Callus, score: 84.176 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220960199 | NA | 6.22E-07 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960199 | 1.62E-06 | 1.62E-06 | mr1098 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960199 | 7.83E-09 | 7.83E-09 | mr1099 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960199 | 5.32E-09 | 8.98E-10 | mr1101 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960199 | 1.31E-06 | 7.81E-07 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960199 | 7.00E-08 | 4.83E-08 | mr1150 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960199 | 1.31E-06 | 2.01E-06 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960199 | 1.71E-06 | 4.68E-07 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960199 | 7.85E-06 | 7.85E-06 | mr1589 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220960199 | 2.43E-06 | 2.43E-06 | mr1595 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/