Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220854220:

Variant ID: vg0220854220 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 20854220
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAGGTACAATAGAATTGTTTTATTAGATGCAAAAATACCATGTTAGATTGTTTGGTGCTTTCAAAGAGAGAAGAGAGAGAAGGAATGCAGGCCACAAAAT[A/G]
AGCGCCAACTACAACACATTCCTCCACACCTGGTGAGCCTCATTCCATGCTCAGCTCTTCGTGATTGGTGAAACCGTGCTAGCCTGCGCACAGGATAGGA

Reverse complement sequence

TCCTATCCTGTGCGCAGGCTAGCACGGTTTCACCAATCACGAAGAGCTGAGCATGGAATGAGGCTCACCAGGTGTGGAGGAATGTGTTGTAGTTGGCGCT[T/C]
ATTTTGTGGCCTGCATTCCTTCTCTCTCTTCTCTCTTTGAAAGCACCAAACAATCTAACATGGTATTTTTGCATCTAATAAAACAATTCTATTGTACCTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.40%	8.10%	0.42%	0.06%	NA
All Indica	2759	91.80%	7.50%	0.54%	0.11%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	38.70%	59.50%	1.86%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	74.20%	24.90%	0.86%	0.00%	NA
Indica III	913	95.00%	4.80%	0.11%	0.11%	NA
Indica Intermediate	786	92.50%	6.00%	1.27%	0.25%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0220854220	A -> G	LOC_Os02g34770.1	upstream_gene_variant ; 3070.0bp to feature; MODIFIER	silent_mutation	Average:70.423; most accessible tissue: Callus, score: 94.649	N	N	N	N
vg0220854220	A -> G	LOC_Os02g34780.1	upstream_gene_variant ; 1162.0bp to feature; MODIFIER	silent_mutation	Average:70.423; most accessible tissue: Callus, score: 94.649	N	N	N	N
vg0220854220	A -> G	LOC_Os02g34790.1	downstream_gene_variant ; 2824.0bp to feature; MODIFIER	silent_mutation	Average:70.423; most accessible tissue: Callus, score: 94.649	N	N	N	N
vg0220854220	A -> G	LOC_Os02g34780-LOC_Os02g34790	intergenic_region ; MODIFIER	silent_mutation	Average:70.423; most accessible tissue: Callus, score: 94.649	N	N	N	N
vg0220854220	A -> DEL	N	N	silent_mutation	Average:70.423; most accessible tissue: Callus, score: 94.649	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0220854220	NA	9.29E-06	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854220	NA	1.25E-18	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854220	NA	7.13E-07	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854220	NA	1.76E-16	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854220	9.06E-06	5.66E-07	mr1422	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854220	NA	6.59E-06	mr1771	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854220	4.64E-06	NA	mr1917	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854220	6.04E-06	6.35E-07	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220854220	1.27E-06	NA	mr1936	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251