Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219806820:

Variant ID: vg0219806820 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 19806820
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCTCACCGTGCATGGCAGAGAGAGAGAGGGGCATGTGGCCTTGCAAGGGAGAATGATAGGCACGGTTCAGGATAGGAGCGAATATGAAGGGGAGAAGAG[C/T]
GACATGTGCATGAAGATAAGGACGCATGAGGGAATAAGGACATGATTTTTTTCTTTCTCATGCTCCACGCCCGTCGGCTCGGCTCGGTTTGATGGAGTGT

Reverse complement sequence

ACACTCCATCAAACCGAGCCGAGCCGACGGGCGTGGAGCATGAGAAAGAAAAAAATCATGTCCTTATTCCCTCATGCGTCCTTATCTTCATGCACATGTC[G/A]
CTCTTCTCCCCTTCATATTCGCTCCTATCCTGAACCGTGCCTATCATTCTCCCTTGCAAGGCCACATGCCCCTCTCTCTCTCTGCCATGCACGGTGAGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.80%	9.70%	0.44%	0.00%	NA
All Indica	2759	99.50%	0.30%	0.22%	0.00%	NA
All Japonica	1512	70.60%	28.80%	0.66%	0.00%	NA
Aus	269	98.90%	0.00%	1.12%	0.00%	NA
Indica I	595	99.00%	0.50%	0.50%	0.00%	NA
Indica II	465	99.40%	0.20%	0.43%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.40%	0.13%	0.00%	NA
Temperate Japonica	767	95.60%	4.20%	0.26%	0.00%	NA
Tropical Japonica	504	28.00%	70.40%	1.59%	0.00%	NA
Japonica Intermediate	241	80.10%	19.90%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	16.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0219806820	C -> T	LOC_Os02g33335.1	upstream_gene_variant ; 4647.0bp to feature; MODIFIER	silent_mutation	Average:62.715; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N
vg0219806820	C -> T	LOC_Os02g33340.1	upstream_gene_variant ; 1102.0bp to feature; MODIFIER	silent_mutation	Average:62.715; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N
vg0219806820	C -> T	LOC_Os02g33335-LOC_Os02g33340	intergenic_region ; MODIFIER	silent_mutation	Average:62.715; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0219806820	NA	3.13E-08	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820	NA	8.84E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820	NA	5.87E-29	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820	NA	6.16E-10	mr1089_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820	NA	3.00E-07	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820	NA	7.96E-11	mr1093_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820	NA	3.01E-12	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820	NA	1.17E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820	NA	3.36E-06	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820	NA	4.30E-07	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820	NA	3.13E-07	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820	NA	1.73E-06	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820	NA	1.47E-34	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820	2.94E-07	NA	mr1733_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820	NA	7.22E-09	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820	NA	4.89E-07	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820	NA	9.43E-07	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251