Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219732180:

Variant ID: vg0219732180 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 19732180
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

ATTGCCGGAGATTATATAAGATATATGATAACCCGGCGAATTACATAAACAAGATTAGAGTGTCATGAAGATGGAAGCACTAATCCCGAGAACGCAAGCC[A/G]
CCATAACAAGTTTTACCTCTTGTTGAAGATCGATACCGATGTAGCTCAACCCGAAAGCAAGAACTCGTCGAAACAAAACGGAAGTAAAAAGGGTGGCGAT

Reverse complement sequence

ATCGCCACCCTTTTTACTTCCGTTTTGTTTCGACGAGTTCTTGCTTTCGGGTTGAGCTACATCGGTATCGATCTTCAACAAGAGGTAAAACTTGTTATGG[T/C]
GGCTTGCGTTCTCGGGATTAGTGCTTCCATCTTCATGACACTCTAATCTTGTTTATGTAATTCGCCGGGTTATCATATATCTTATATAATCTCCGGCAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.50%	43.70%	0.57%	0.17%	NA
All Indica	2759	84.50%	14.60%	0.72%	0.22%	NA
All Japonica	1512	14.20%	85.50%	0.20%	0.07%	NA
Aus	269	17.80%	82.20%	0.00%	0.00%	NA
Indica I	595	75.30%	23.00%	1.34%	0.34%	NA
Indica II	465	82.60%	16.30%	0.86%	0.22%	NA
Indica III	913	93.30%	6.50%	0.22%	0.00%	NA
Indica Intermediate	786	82.30%	16.50%	0.76%	0.38%	NA
Temperate Japonica	767	22.70%	76.90%	0.26%	0.13%	NA
Tropical Japonica	504	1.60%	98.20%	0.20%	0.00%	NA
Japonica Intermediate	241	13.70%	86.30%	0.00%	0.00%	NA
VI/Aromatic	96	0.00%	100.00%	0.00%	0.00%	NA
Intermediate	90	34.40%	60.00%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0219732180	A -> G	LOC_Os02g33180.1	upstream_gene_variant ; 2292.0bp to feature; MODIFIER	silent_mutation	Average:59.594; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0219732180	A -> G	LOC_Os02g33190.1	upstream_gene_variant ; 1784.0bp to feature; MODIFIER	silent_mutation	Average:59.594; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0219732180	A -> G	LOC_Os02g33180-LOC_Os02g33190	intergenic_region ; MODIFIER	silent_mutation	Average:59.594; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0219732180	A -> DEL	N	N	silent_mutation	Average:59.594; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0219732180	NA	7.19E-06	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219732180	NA	4.29E-06	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219732180	1.14E-06	9.59E-08	mr1519	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219732180	NA	4.20E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219732180	NA	1.80E-11	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219732180	NA	5.75E-06	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219732180	NA	4.89E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251