Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219447107:

Variant ID: vg0219447107 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 19447107
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.20, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

CTACGACCCGTCCACTGTCTTTTCTCTTTATTGTCATTGGGATTTTAAAAATCGAACATAATTATCGTTCAGGTTCATTTTTTTACTTTCTAGAAGTCCC[A/G]
CCAAACCGTCAGCGGCTTTACAATTGTACTCCTTCATGGCTCGCATGCTGCCTCCCTTTTTTATTGTAATTGACATTTTAAAATCAAACATGATTTTAGA

Reverse complement sequence

TCTAAAATCATGTTTGATTTTAAAATGTCAATTACAATAAAAAAGGGAGGCAGCATGCGAGCCATGAAGGAGTACAATTGTAAAGCCGCTGACGGTTTGG[T/C]
GGGACTTCTAGAAAGTAAAAAAATGAACCTGAACGATAATTATGTTCGATTTTTAAAATCCCAATGACAATAAAGAGAAAAGACAGTGGACGGGTCGTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.60%	47.10%	0.32%	0.02%	NA
All Indica	2759	77.00%	22.50%	0.47%	0.04%	NA
All Japonica	1512	18.10%	81.90%	0.07%	0.00%	NA
Aus	269	6.30%	93.70%	0.00%	0.00%	NA
Indica I	595	56.50%	43.40%	0.17%	0.00%	NA
Indica II	465	79.10%	20.40%	0.43%	0.00%	NA
Indica III	913	92.80%	6.90%	0.22%	0.11%	NA
Indica Intermediate	786	72.90%	26.10%	1.02%	0.00%	NA
Temperate Japonica	767	8.50%	91.40%	0.13%	0.00%	NA
Tropical Japonica	504	27.80%	72.20%	0.00%	0.00%	NA
Japonica Intermediate	241	28.20%	71.80%	0.00%	0.00%	NA
VI/Aromatic	96	32.30%	67.70%	0.00%	0.00%	NA
Intermediate	90	43.30%	55.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0219447107	A -> G	LOC_Os02g32740.1	downstream_gene_variant ; 688.0bp to feature; MODIFIER	silent_mutation	Average:36.689; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0219447107	A -> G	LOC_Os02g32750.1	downstream_gene_variant ; 4458.0bp to feature; MODIFIER	silent_mutation	Average:36.689; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0219447107	A -> G	LOC_Os02g32750.2	downstream_gene_variant ; 3252.0bp to feature; MODIFIER	silent_mutation	Average:36.689; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0219447107	A -> G	LOC_Os02g32740-LOC_Os02g32750	intergenic_region ; MODIFIER	silent_mutation	Average:36.689; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0219447107	A -> DEL	N	N	silent_mutation	Average:36.689; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0219447107	NA	1.41E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219447107	NA	6.40E-07	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219447107	NA	8.23E-06	mr1352	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219447107	NA	4.60E-06	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219447107	NA	4.56E-08	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219447107	NA	6.34E-18	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219447107	NA	1.23E-08	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219447107	NA	2.07E-21	mr1183_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219447107	NA	2.65E-07	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219447107	NA	1.79E-08	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219447107	NA	5.64E-08	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251