Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219058637:

Variant ID: vg0219058637 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 19058637
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, A: 0.13, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCATATGTAAGCTATTGAGTCAATCTTGAAGATTTGATTTTTTTTTCATTTAATTCAAAAGAAATTATACTTTGAAAAGAGGTGAACGATTTTTTTTT[A/T]
AAAAAAGTAGTAACTTTCATATTCATCTTAGGCAAAATGGGGGAAAAAAAAGGCCACGTCACCTCTCAGTGCCAGCTATATTATCACCTACTACTGCCAC

Reverse complement sequence

GTGGCAGTAGTAGGTGATAATATAGCTGGCACTGAGAGGTGACGTGGCCTTTTTTTTCCCCCATTTTGCCTAAGATGAATATGAAAGTTACTACTTTTTT[T/A]
AAAAAAAAATCGTTCACCTCTTTTCAAAGTATAATTTCTTTTGAATTAAATGAAAAAAAAATCAAATCTTCAAGATTGACTCAATAGCTTACATATGGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.90% 14.00% 3.11% 0.00% NA
All Indica  2759 82.00% 16.40% 1.59% 0.00% NA
All Japonica  1512 81.80% 11.80% 6.42% 0.00% NA
Aus  269 94.40% 4.50% 1.12% 0.00% NA
Indica I  595 89.10% 6.70% 4.20% 0.00% NA
Indica II  465 87.30% 11.60% 1.08% 0.00% NA
Indica III  913 70.50% 28.90% 0.55% 0.00% NA
Indica Intermediate  786 86.80% 12.10% 1.15% 0.00% NA
Temperate Japonica  767 70.10% 19.70% 10.17% 0.00% NA
Tropical Japonica  504 96.20% 2.00% 1.79% 0.00% NA
Japonica Intermediate  241 88.80% 7.10% 4.15% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 80.00% 17.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219058637 A -> T LOC_Os02g32280.1 upstream_gene_variant ; 236.0bp to feature; MODIFIER silent_mutation Average:95.89; most accessible tissue: Zhenshan97 young leaf, score: 97.404 N N N N
vg0219058637 A -> T LOC_Os02g32270.1 downstream_gene_variant ; 4191.0bp to feature; MODIFIER silent_mutation Average:95.89; most accessible tissue: Zhenshan97 young leaf, score: 97.404 N N N N
vg0219058637 A -> T LOC_Os02g32270-LOC_Os02g32280 intergenic_region ; MODIFIER silent_mutation Average:95.89; most accessible tissue: Zhenshan97 young leaf, score: 97.404 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0219058637 A T -0.01 -0.02 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0219058637 NA 8.79E-13 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 5.73E-07 1.85E-15 mr1017 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 1.69E-12 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 5.38E-06 2.19E-12 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 2.97E-13 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 4.01E-14 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 3.93E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 5.81E-07 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 6.70E-12 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 1.68E-11 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 3.70E-12 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 4.60E-13 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 4.30E-12 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 1.01E-10 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 3.11E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 6.05E-10 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 6.64E-13 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 3.63E-13 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 1.19E-11 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 5.90E-13 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 1.38E-14 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 7.04E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219058637 NA 4.74E-14 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251