Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218989953:

Variant ID: vg0218989953 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 18989953
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

TAATATATCACTCCACAAACATTAAAATTCAACTTCTACAAATTGTAACAAAAATAAAAAATAAAACTCAAATTAGTAAGGTATATTTGCAATTATATTT[T/G]
TTATTTTTGTTACAACCTGTAAATGTTGAATCTGAACTTGCATGTTTACAGAGTGAATATTACATATTGATCTATCTTGTCAAAATTTTTTTAAAAAAAA

Reverse complement sequence

TTTTTTTTAAAAAAATTTTGACAAGATAGATCAATATGTAATATTCACTCTGTAAACATGCAAGTTCAGATTCAACATTTACAGGTTGTAACAAAAATAA[A/C]
AAATATAATTGCAAATATACCTTACTAATTTGAGTTTTATTTTTTATTTTTGTTACAATTTGTAGAAGTTGAATTTTAATGTTTGTGGAGTGATATATTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.00%	46.80%	0.21%	0.02%	NA
All Indica	2759	84.90%	14.80%	0.29%	0.04%	NA
All Japonica	1512	4.00%	96.00%	0.07%	0.00%	NA
Aus	269	18.60%	81.40%	0.00%	0.00%	NA
Indica I	595	65.70%	33.30%	1.01%	0.00%	NA
Indica II	465	90.50%	9.50%	0.00%	0.00%	NA
Indica III	913	94.00%	6.00%	0.00%	0.00%	NA
Indica Intermediate	786	85.50%	14.10%	0.25%	0.13%	NA
Temperate Japonica	767	1.80%	98.20%	0.00%	0.00%	NA
Tropical Japonica	504	6.70%	93.30%	0.00%	0.00%	NA
Japonica Intermediate	241	5.00%	94.60%	0.41%	0.00%	NA
VI/Aromatic	96	18.80%	81.20%	0.00%	0.00%	NA
Intermediate	90	38.90%	60.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0218989953	T -> G	LOC_Os02g32140.1	upstream_gene_variant ; 1098.0bp to feature; MODIFIER	silent_mutation	Average:35.52; most accessible tissue: Callus, score: 65.341	N	N	N	N
vg0218989953	T -> G	LOC_Os02g32130.1	downstream_gene_variant ; 4760.0bp to feature; MODIFIER	silent_mutation	Average:35.52; most accessible tissue: Callus, score: 65.341	N	N	N	N
vg0218989953	T -> G	LOC_Os02g32160.1	downstream_gene_variant ; 4061.0bp to feature; MODIFIER	silent_mutation	Average:35.52; most accessible tissue: Callus, score: 65.341	N	N	N	N
vg0218989953	T -> G	LOC_Os02g32140-LOC_Os02g32160	intergenic_region ; MODIFIER	silent_mutation	Average:35.52; most accessible tissue: Callus, score: 65.341	N	N	N	N
vg0218989953	T -> DEL	N	N	silent_mutation	Average:35.52; most accessible tissue: Callus, score: 65.341	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0218989953	NA	4.64E-08	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218989953	3.00E-06	NA	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218989953	3.88E-06	NA	mr1658	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218989953	NA	4.65E-06	mr1658	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218989953	NA	2.90E-12	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218989953	NA	9.09E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218989953	NA	1.07E-12	mr1330_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218989953	NA	1.11E-08	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218989953	NA	4.54E-07	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218989953	NA	6.42E-06	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251