Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218913885:

Variant ID: vg0218913885 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 18913885
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.81, C: 0.19, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TTATACTTGGTGATACCATGTGCTTTGCTACGGAATATATGGATGAAAATATGTTTAATATTATAGAAATGATAAATGTTGAAGTATTGTGAAAATGATG[C/T]
GAGGAAGATGATATGATATATGTTGAGCTCTAGTATTATATTTTGCATGATTAGTCATGCTTGTATGATATTTAAAATACTCTATAATAGTAATTGTTAG

Reverse complement sequence

CTAACAATTACTATTATAGAGTATTTTAAATATCATACAAGCATGACTAATCATGCAAAATATAATACTAGAGCTCAACATATATCATATCATCTTCCTC[G/A]
CATCATTTTCACAATACTTCAACATTTATCATTTCTATAATATTAAACATATTTTCATCCATATATTCCGTAGCAAAGCACATGGTATCACCAAGTATAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.40%	47.10%	0.49%	0.00%	NA
All Indica	2759	83.70%	15.60%	0.76%	0.00%	NA
All Japonica	1512	4.10%	95.80%	0.13%	0.00%	NA
Aus	269	19.30%	80.70%	0.00%	0.00%	NA
Indica I	595	70.10%	29.10%	0.84%	0.00%	NA
Indica II	465	83.40%	16.10%	0.43%	0.00%	NA
Indica III	913	92.20%	7.40%	0.33%	0.00%	NA
Indica Intermediate	786	84.10%	14.50%	1.40%	0.00%	NA
Temperate Japonica	767	1.80%	98.00%	0.13%	0.00%	NA
Tropical Japonica	504	6.90%	93.10%	0.00%	0.00%	NA
Japonica Intermediate	241	5.40%	94.20%	0.41%	0.00%	NA
VI/Aromatic	96	14.60%	85.40%	0.00%	0.00%	NA
Intermediate	90	44.40%	55.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0218913885	C -> T	LOC_Os02g32030.1	upstream_gene_variant ; 3049.0bp to feature; MODIFIER	silent_mutation	Average:48.877; most accessible tissue: Minghui63 root, score: 63.915	N	N	N	N
vg0218913885	C -> T	LOC_Os02g32009.1	downstream_gene_variant ; 4318.0bp to feature; MODIFIER	silent_mutation	Average:48.877; most accessible tissue: Minghui63 root, score: 63.915	N	N	N	N
vg0218913885	C -> T	LOC_Os02g32020.1	downstream_gene_variant ; 811.0bp to feature; MODIFIER	silent_mutation	Average:48.877; most accessible tissue: Minghui63 root, score: 63.915	N	N	N	N
vg0218913885	C -> T	LOC_Os02g32020-LOC_Os02g32030	intergenic_region ; MODIFIER	silent_mutation	Average:48.877; most accessible tissue: Minghui63 root, score: 63.915	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0218913885	NA	8.27E-18	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218913885	NA	2.68E-08	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218913885	NA	9.92E-07	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218913885	NA	2.97E-07	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218913885	NA	1.88E-08	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218913885	NA	3.33E-08	mr1733_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218913885	NA	1.06E-06	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251