Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218787476:

Variant ID: vg0218787476 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 18787476
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

TACTTTTGTCACCAAAACCAAGAAAATATTAAATCATCTTGGATGTTATAAAATCAAGGAGTAAATGCAAGCATGCAAGTATGCAACCAATGAATATTTA[G/A]
ATGACTCCTCCGGTTCTAATCAAACATTTAATTTATCTCTTCATTTAAGTCTTAAATACATAAAGACTATAAATAGGAACAACTTATTTGGAAAAACTCA

Reverse complement sequence

TGAGTTTTTCCAAATAAGTTGTTCCTATTTATAGTCTTTATGTATTTAAGACTTAAATGAAGAGATAAATTAAATGTTTGATTAGAACCGGAGGAGTCAT[C/T]
TAAATATTCATTGGTTGCATACTTGCATGCTTGCATTTACTCCTTGATTTTATAACATCCAAGATGATTTAATATTTTCTTGGTTTTGGTGACAAAAGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.70%	26.30%	3.89%	8.02%	NA
All Indica	2759	39.90%	41.00%	6.20%	12.83%	NA
All Japonica	1512	97.90%	2.10%	0.07%	0.00%	NA
Aus	269	69.10%	20.10%	2.23%	8.55%	NA
Indica I	595	57.50%	30.30%	4.20%	8.07%	NA
Indica II	465	39.40%	50.80%	4.30%	5.59%	NA
Indica III	913	34.90%	37.10%	6.79%	21.14%	NA
Indica Intermediate	786	32.80%	48.00%	8.14%	11.07%	NA
Temperate Japonica	767	98.30%	1.70%	0.00%	0.00%	NA
Tropical Japonica	504	98.20%	1.80%	0.00%	0.00%	NA
Japonica Intermediate	241	95.90%	3.70%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	61.10%	30.00%	6.67%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0218787476	G -> A	LOC_Os02g31310.1	upstream_gene_variant ; 1732.0bp to feature; MODIFIER	silent_mutation	Average:15.046; most accessible tissue: Zhenshan97 root, score: 22.162	N	N	N	N
vg0218787476	G -> A	LOC_Os02g31320.1	upstream_gene_variant ; 2328.0bp to feature; MODIFIER	silent_mutation	Average:15.046; most accessible tissue: Zhenshan97 root, score: 22.162	N	N	N	N
vg0218787476	G -> A	LOC_Os02g31310-LOC_Os02g31320	intergenic_region ; MODIFIER	silent_mutation	Average:15.046; most accessible tissue: Zhenshan97 root, score: 22.162	N	N	N	N
vg0218787476	G -> DEL	N	N	silent_mutation	Average:15.046; most accessible tissue: Zhenshan97 root, score: 22.162	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0218787476	NA	9.48E-07	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476	NA	4.70E-06	mr1251	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476	NA	2.33E-07	mr1255	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476	NA	8.32E-06	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476	NA	3.02E-08	mr1599	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476	NA	1.02E-07	mr1093_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476	NA	3.16E-10	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476	NA	3.89E-09	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476	NA	4.26E-06	mr1253_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476	NA	1.64E-22	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476	NA	2.54E-10	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476	NA	1.36E-10	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476	NA	2.62E-14	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476	NA	1.51E-06	mr1377_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476	NA	3.72E-06	mr1423_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476	NA	4.60E-09	mr1435_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476	NA	1.61E-06	mr1577_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476	NA	1.86E-08	mr1599_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251