Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218664196:

Variant ID: vg0218664196 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 18664196
Reference Allele: AGGTCCCAAAAC	Alternative Allele: GGGTCCCAAAAC,AGGGGTCCCAAAAC,A,AGAGGGGTCCCAAAAC
Primary Allele: AGGTCCCAAAAC	Secondary Allele: GGGTCCCAAAAC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAGGAGAGAAGTAAATAAAACGGCGGCAAATCAAAAGGTTGTGGGAGATTTGGGCATGATCCTAAGAGGATATCGCCCATAGAGAGAGAGAGAGAGAG[AGGTCCCAAAAC/GGGTCCCAAAAC,AGGGGTCCCAAAAC,A,AGAGGGGTCCCAAAAC]
GAGAGGCGTGGCTCTTCCATTGTTCCATGCACCTCGCTTGCTTGCTTGCTCGCTCGCTCGCTCGAGCCTCCTGTAACTTTCAGTGTCAACTTCCCCTTTT

Reverse complement sequence

AAAAGGGGAAGTTGACACTGAAAGTTACAGGAGGCTCGAGCGAGCGAGCGAGCAAGCAAGCAAGCGAGGTGCATGGAACAATGGAAGAGCCACGCCTCTC[GTTTTGGGACCT/GTTTTGGGACCC,GTTTTGGGACCCCT,T,GTTTTGGGACCCCTCT]
CTCTCTCTCTCTCTCTCTATGGGCGATATCCTCTTAGGATCATGCCCAAATCTCCCACAACCTTTTGATTTGCCGCCGTTTTATTTACTTCTCTCCTTTT

Allele Frequencies:

Populations	Population Size	Frequency of AGGTCCCAAAAC(primary allele)	Frequency of GGGTCCCAAAAC(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.10%	7.90%	0.08%	0.00%	AGGGGTCCCAAAAC: 0.91%; A: 0.04%; AGAGGGGTCCCAAAAC: 0.02%
All Indica	2759	90.80%	9.00%	0.07%	0.00%	A: 0.07%
All Japonica	1512	90.30%	6.70%	0.13%	0.00%	AGGGGTCCCAAAAC: 2.78%; AGAGGGGTCCCAAAAC: 0.07%
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.00%	0.00%	A: 0.17%
Indica II	465	90.50%	9.50%	0.00%	0.00%	NA
Indica III	913	80.50%	19.30%	0.11%	0.00%	A: 0.11%
Indica Intermediate	786	96.20%	3.70%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.00%	AGGGGTCCCAAAAC: 0.13%
Tropical Japonica	504	74.40%	17.70%	0.40%	0.00%	AGGGGTCCCAAAAC: 7.34%; AGAGGGGTCCCAAAAC: 0.20%
Japonica Intermediate	241	93.40%	5.00%	0.00%	0.00%	AGGGGTCCCAAAAC: 1.66%
VI/Aromatic	96	85.40%	14.60%	0.00%	0.00%	NA
Intermediate	90	91.10%	7.80%	0.00%	0.00%	AGGGGTCCCAAAAC: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0218664196	AGGTCCCAAAAC -> A	LOC_Os02g31160.1	upstream_gene_variant ; 2360.0bp to feature; MODIFIER	silent_mutation	Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108	N	N	N	N
vg0218664196	AGGTCCCAAAAC -> A	LOC_Os02g31170.1	upstream_gene_variant ; 2697.0bp to feature; MODIFIER	silent_mutation	Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108	N	N	N	N
vg0218664196	AGGTCCCAAAAC -> A	LOC_Os02g31160-LOC_Os02g31170	intergenic_region ; MODIFIER	silent_mutation	Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108	N	N	N	N
vg0218664196	AGGTCCCAAAAC -> AGAGGGGTCCCAAAAC	LOC_Os02g31160.1	upstream_gene_variant ; 2361.0bp to feature; MODIFIER	silent_mutation	Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108	N	N	N	N
vg0218664196	AGGTCCCAAAAC -> AGAGGGGTCCCAAAAC	LOC_Os02g31170.1	upstream_gene_variant ; 2696.0bp to feature; MODIFIER	silent_mutation	Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108	N	N	N	N
vg0218664196	AGGTCCCAAAAC -> AGAGGGGTCCCAAAAC	LOC_Os02g31160-LOC_Os02g31170	intergenic_region ; MODIFIER	silent_mutation	Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108	N	N	N	N
vg0218664196	AGGTCCCAAAAC -> AGGGGTCCCAAAAC	LOC_Os02g31160.1	upstream_gene_variant ; 2362.0bp to feature; MODIFIER	silent_mutation	Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108	N	N	N	N
vg0218664196	AGGTCCCAAAAC -> AGGGGTCCCAAAAC	LOC_Os02g31170.1	upstream_gene_variant ; 2695.0bp to feature; MODIFIER	silent_mutation	Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108	N	N	N	N
vg0218664196	AGGTCCCAAAAC -> AGGGGTCCCAAAAC	LOC_Os02g31160-LOC_Os02g31170	intergenic_region ; MODIFIER	silent_mutation	Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108	N	N	N	N
vg0218664196	AGGTCCCAAAAC -> GGGTCCCAAAAC	LOC_Os02g31160.1	upstream_gene_variant ; 2359.0bp to feature; MODIFIER	silent_mutation	Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108	N	N	N	N
vg0218664196	AGGTCCCAAAAC -> GGGTCCCAAAAC	LOC_Os02g31170.1	upstream_gene_variant ; 2698.0bp to feature; MODIFIER	silent_mutation	Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108	N	N	N	N
vg0218664196	AGGTCCCAAAAC -> GGGTCCCAAAAC	LOC_Os02g31160-LOC_Os02g31170	intergenic_region ; MODIFIER	silent_mutation	Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0218664196	AGGTC*	A	0.18	0.32	0.2	0.02	0.06	-0.08
vg0218664196	AGGTC*	AGAGG*	0.33	0.32	0.28	0.07	0.14	0.07
vg0218664196	AGGTC*	AGGGG*	0.04	-0.01	-0.09	-0.04	0.01	-0.03
vg0218664196	AGGTC*	GGGTC*	0.04	0.01	0.0	0.04	0.03	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0218664196	NA	6.35E-06	mr1050	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196	3.03E-06	NA	mr1093	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196	NA	1.54E-09	mr1093	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196	NA	3.45E-06	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196	2.91E-07	5.67E-09	mr1272	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196	NA	4.81E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196	NA	1.25E-08	mr1089_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196	NA	2.00E-11	mr1093_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196	NA	2.00E-06	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196	NA	2.29E-06	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196	NA	1.11E-06	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196	NA	2.27E-14	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196	NA	1.91E-09	mr1235_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196	NA	3.11E-06	mr1258_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196	NA	1.88E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196	NA	4.25E-06	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196	1.55E-06	NA	mr1552_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196	7.84E-06	7.53E-07	mr1552_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196	NA	1.46E-08	mr1599_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251