| Variant ID: vg0218156828 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 18156828 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 81. )
GATTGTCTGAAGCGCTTGTGCAGGTAGCTTTGTGTGTTTGCTGTGGAATTGACAGGCTTCACATCGCTGGACCATGTCGCATGCATCTTTAAGGGCGATT[G/A,T]
GCCAGAAAAACCCTTATCGAAAGGCTTTGCCGACCAATGTCCGACCGGCGGCGTGTGACCCGCATATGCCTTCATGTATGTCGAGGAGGAGTTGTCTGCC
GGCAGACAACTCCTCCTCGACATACATGAAGGCATATGCGGGTCACACGCCGCCGGTCGGACATTGGTCGGCAAAGCCTTTCGATAAGGGTTTTTCTGGC[C/T,A]
AATCGCCCTTAAAGATGCATGCGACATGGTCCAGCGATGTGAAGCCTGTCAATTCCACAGCAAACACACAAAGCTACCTGCACAAGCGCTTCAGACAATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.80% | 21.50% | 17.65% | 12.95% | T: 0.13% |
| All Indica | 2759 | 35.50% | 33.20% | 28.81% | 2.32% | T: 0.14% |
| All Japonica | 1512 | 61.70% | 1.40% | 1.19% | 35.65% | T: 0.07% |
| Aus | 269 | 79.60% | 17.80% | 2.60% | 0.00% | NA |
| Indica I | 595 | 24.70% | 26.40% | 44.87% | 4.03% | NA |
| Indica II | 465 | 74.00% | 10.80% | 13.12% | 2.15% | NA |
| Indica III | 913 | 19.80% | 50.90% | 27.71% | 1.42% | T: 0.11% |
| Indica Intermediate | 786 | 39.10% | 31.20% | 27.23% | 2.16% | T: 0.38% |
| Temperate Japonica | 767 | 94.90% | 0.30% | 0.13% | 4.69% | NA |
| Tropical Japonica | 504 | 11.10% | 1.80% | 1.79% | 85.12% | T: 0.20% |
| Japonica Intermediate | 241 | 61.80% | 4.10% | 3.32% | 30.71% | NA |
| VI/Aromatic | 96 | 95.80% | 2.10% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 46.70% | 28.90% | 14.44% | 8.89% | T: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0218156828 | G -> A | LOC_Os02g30490.1 | upstream_gene_variant ; 4305.0bp to feature; MODIFIER | silent_mutation | Average:20.458; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| vg0218156828 | G -> A | LOC_Os02g30500.1 | downstream_gene_variant ; 1856.0bp to feature; MODIFIER | silent_mutation | Average:20.458; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| vg0218156828 | G -> A | LOC_Os02g30520.1 | downstream_gene_variant ; 2216.0bp to feature; MODIFIER | silent_mutation | Average:20.458; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| vg0218156828 | G -> A | LOC_Os02g30510.1 | intron_variant ; MODIFIER | silent_mutation | Average:20.458; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| vg0218156828 | G -> T | LOC_Os02g30490.1 | upstream_gene_variant ; 4305.0bp to feature; MODIFIER | silent_mutation | Average:20.458; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| vg0218156828 | G -> T | LOC_Os02g30500.1 | downstream_gene_variant ; 1856.0bp to feature; MODIFIER | silent_mutation | Average:20.458; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| vg0218156828 | G -> T | LOC_Os02g30520.1 | downstream_gene_variant ; 2216.0bp to feature; MODIFIER | silent_mutation | Average:20.458; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| vg0218156828 | G -> T | LOC_Os02g30510.1 | intron_variant ; MODIFIER | silent_mutation | Average:20.458; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| vg0218156828 | G -> DEL | N | N | silent_mutation | Average:20.458; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0218156828 | NA | 3.57E-06 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218156828 | NA | 1.33E-06 | mr1622 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218156828 | NA | 7.21E-09 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218156828 | NA | 4.45E-07 | mr1895_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218156828 | NA | 3.83E-06 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218156828 | NA | 4.64E-06 | mr1899_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218156828 | NA | 9.37E-06 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |