Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218153756:

Variant ID: vg0218153756 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 18153756
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACCTAGGCACGAGAGGGGACTGCCCGCTGCCTTGCGAGGAGTGGGGGTGAAACCTAAGGTGTGGTGTGCTTGGTTAGAGGGGGTTATGCGAAGGGTCCT[A/G]
TCATGGCCTCTTTCCGGTATGTCGTGGTGGCATGTCGGGGCACGGAAGCGTGTCGTGGGGCTGTTTCTTGTGGGTACAGTTGTACACCTCTGATCAGAGT

Reverse complement sequence

ACTCTGATCAGAGGTGTACAACTGTACCCACAAGAAACAGCCCCACGACACGCTTCCGTGCCCCGACATGCCACCACGACATACCGGAAAGAGGCCATGA[T/C]
AGGACCCTTCGCATAACCCCCTCTAACCAAGCACACCACACCTTAGGTTTCACCCCCACTCCTCGCAAGGCAGCGGGCAGTCCCCTCTCGTGCCTAGGTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.00%	0.60%	20.12%	41.30%	NA
All Indica	2759	18.20%	0.90%	30.66%	50.16%	NA
All Japonica	1512	60.60%	0.10%	4.70%	34.59%	NA
Aus	269	89.20%	0.00%	7.43%	3.35%	NA
Indica I	595	21.80%	0.70%	28.07%	49.41%	NA
Indica II	465	25.40%	0.00%	15.70%	58.92%	NA
Indica III	913	11.60%	1.30%	42.39%	44.69%	NA
Indica Intermediate	786	19.00%	1.30%	27.86%	51.91%	NA
Temperate Japonica	767	94.50%	0.00%	0.13%	5.35%	NA
Tropical Japonica	504	9.10%	0.40%	13.10%	77.38%	NA
Japonica Intermediate	241	60.20%	0.00%	1.66%	38.17%	NA
VI/Aromatic	96	97.90%	0.00%	1.04%	1.04%	NA
Intermediate	90	46.70%	0.00%	14.44%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0218153756	A -> G	LOC_Os02g30490.1	upstream_gene_variant ; 1233.0bp to feature; MODIFIER	silent_mutation	Average:19.5; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg0218153756	A -> G	LOC_Os02g30500.1	upstream_gene_variant ; 3.0bp to feature; MODIFIER	silent_mutation	Average:19.5; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg0218153756	A -> G	LOC_Os02g30480.1	downstream_gene_variant ; 2896.0bp to feature; MODIFIER	silent_mutation	Average:19.5; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg0218153756	A -> G	LOC_Os02g30510.1	downstream_gene_variant ; 2102.0bp to feature; MODIFIER	silent_mutation	Average:19.5; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg0218153756	A -> G	LOC_Os02g30490-LOC_Os02g30500	intergenic_region ; MODIFIER	silent_mutation	Average:19.5; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg0218153756	A -> DEL	N	N	silent_mutation	Average:19.5; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0218153756	7.65E-07	NA	mr1216	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218153756	2.78E-06	2.70E-09	mr1785	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218153756	2.44E-06	8.65E-07	mr1785	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218153756	NA	5.82E-06	mr1947	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218153756	3.66E-07	3.66E-07	mr1947	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251