Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217845387:

Variant ID: vg0217845387 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17845387
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

GAAGTCGAGGCTGCCGAACCGGAACGCCTGCCTAGGAGGGAAGACGAAGTCGTCGATGTCGGAAACGAAACCCATCGCATTAGTCGGCGAAGTACTTGAC[A/G]
CTACCCCTACTTGGCGCGCCAACTGTCAAAACAAGATTTCGACAATACTAAAGGGGGTGGCTATCAAACTGGAAAAGTGGATGGTTTAAGAGACAAGGAA

Reverse complement sequence

TTCCTTGTCTCTTAAACCATCCACTTTTCCAGTTTGATAGCCACCCCCTTTAGTATTGTCGAAATCTTGTTTTGACAGTTGGCGCGCCAAGTAGGGGTAG[T/C]
GTCAAGTACTTCGCCGACTAATGCGATGGGTTTCGTTTCCGACATCGACGACTTCGTCTTCCCTCCTAGGCAGGCGTTCCGGTTCGGCAGCCTCGACTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.30%	20.30%	7.32%	0.02%	NA
All Indica	2759	82.90%	5.40%	11.63%	0.04%	NA
All Japonica	1512	48.70%	51.10%	0.20%	0.00%	NA
Aus	269	87.40%	5.60%	7.06%	0.00%	NA
Indica I	595	76.60%	4.20%	19.16%	0.00%	NA
Indica II	465	94.00%	2.40%	3.66%	0.00%	NA
Indica III	913	80.70%	7.30%	11.94%	0.00%	NA
Indica Intermediate	786	83.60%	6.00%	10.31%	0.13%	NA
Temperate Japonica	767	6.60%	93.40%	0.00%	0.00%	NA
Tropical Japonica	504	98.60%	1.00%	0.40%	0.00%	NA
Japonica Intermediate	241	78.40%	21.20%	0.41%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	81.10%	15.60%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217845387	A -> G	LOC_Os02g30030.1	upstream_gene_variant ; 3718.0bp to feature; MODIFIER	silent_mutation	Average:69.657; most accessible tissue: Minghui63 young leaf, score: 87.217	N	N	N	N
vg0217845387	A -> G	LOC_Os02g30040.1	upstream_gene_variant ; 26.0bp to feature; MODIFIER	silent_mutation	Average:69.657; most accessible tissue: Minghui63 young leaf, score: 87.217	N	N	N	N
vg0217845387	A -> G	LOC_Os02g30050.1	upstream_gene_variant ; 898.0bp to feature; MODIFIER	silent_mutation	Average:69.657; most accessible tissue: Minghui63 young leaf, score: 87.217	N	N	N	N
vg0217845387	A -> G	LOC_Os02g30060.1	downstream_gene_variant ; 2795.0bp to feature; MODIFIER	silent_mutation	Average:69.657; most accessible tissue: Minghui63 young leaf, score: 87.217	N	N	N	N
vg0217845387	A -> G	LOC_Os02g30040-LOC_Os02g30050	intergenic_region ; MODIFIER	silent_mutation	Average:69.657; most accessible tissue: Minghui63 young leaf, score: 87.217	N	N	N	N
vg0217845387	A -> DEL	N	N	silent_mutation	Average:69.657; most accessible tissue: Minghui63 young leaf, score: 87.217	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0217845387	A	G	-0.01	-0.01	-0.01	-0.01	-0.01	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217845387	3.95E-06	3.95E-06	mr1248	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387	NA	1.37E-10	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387	NA	2.86E-06	mr1368	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387	NA	1.11E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387	NA	7.60E-08	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387	NA	5.56E-08	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387	NA	4.66E-08	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387	NA	7.06E-08	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387	NA	9.13E-11	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387	NA	1.87E-07	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387	NA	1.65E-09	mr1864_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251