Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217805111:

Variant ID: vg0217805111 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17805111
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTAATACTTTCTCCACTCCATTTCATATTATAAGATATCTTTATTTTTTTAAGTCTATTTTTTAAGTTTAATATATTTATATAGAAATATAGCAATAT[C/A]
TGTAACACCAAAATAGTATCACTAAATATAATTTTGAGAATATTTTATATTGTATTTGTTTTATATTAAAAATGTTGTTACGTTTTCATACAAACTTGAT

Reverse complement sequence

ATCAAGTTTGTATGAAAACGTAACAACATTTTTAATATAAAACAAATACAATATAAAATATTCTCAAAATTATATTTAGTGATACTATTTTGGTGTTACA[G/T]
ATATTGCTATATTTCTATATAAATATATTAAACTTAAAAAATAGACTTAAAAAAATAAAGATATCTTATAATATGAAATGGAGTGGAGAAAGTATTACAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.20%	15.00%	2.22%	0.57%	NA
All Indica	2759	79.90%	19.70%	0.40%	0.00%	NA
All Japonica	1512	91.80%	0.40%	6.02%	1.79%	NA
Aus	269	75.10%	24.90%	0.00%	0.00%	NA
Indica I	595	84.90%	15.00%	0.17%	0.00%	NA
Indica II	465	90.80%	8.80%	0.43%	0.00%	NA
Indica III	913	69.70%	30.20%	0.11%	0.00%	NA
Indica Intermediate	786	81.70%	17.40%	0.89%	0.00%	NA
Temperate Japonica	767	86.00%	0.00%	10.56%	3.39%	NA
Tropical Japonica	504	99.40%	0.40%	0.20%	0.00%	NA
Japonica Intermediate	241	94.20%	1.70%	3.73%	0.41%	NA
VI/Aromatic	96	18.80%	80.20%	1.04%	0.00%	NA
Intermediate	90	81.10%	16.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217805111	C -> A	LOC_Os02g29960.1	upstream_gene_variant ; 377.0bp to feature; MODIFIER	silent_mutation	Average:62.045; most accessible tissue: Zhenshan97 flag leaf, score: 79.935	N	N	N	N
vg0217805111	C -> A	LOC_Os02g29950.1	downstream_gene_variant ; 2681.0bp to feature; MODIFIER	silent_mutation	Average:62.045; most accessible tissue: Zhenshan97 flag leaf, score: 79.935	N	N	N	N
vg0217805111	C -> A	LOC_Os02g29970.1	downstream_gene_variant ; 4956.0bp to feature; MODIFIER	silent_mutation	Average:62.045; most accessible tissue: Zhenshan97 flag leaf, score: 79.935	N	N	N	N
vg0217805111	C -> A	LOC_Os02g29950-LOC_Os02g29960	intergenic_region ; MODIFIER	silent_mutation	Average:62.045; most accessible tissue: Zhenshan97 flag leaf, score: 79.935	N	N	N	N
vg0217805111	C -> DEL	N	N	silent_mutation	Average:62.045; most accessible tissue: Zhenshan97 flag leaf, score: 79.935	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217805111	NA	1.14E-07	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217805111	NA	2.69E-07	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217805111	2.91E-06	NA	mr1610_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217805111	NA	2.94E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217805111	NA	5.38E-07	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217805111	NA	2.39E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251