Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217324261:

Variant ID: vg0217324261 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17324261
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.08, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCAAAGAGGTTCATACAAGTATACACTAGAGGTTCAACCGATATGATATTTGGGCCTGTTTGGGGGAGCTTAAGATTCTGAGAAGCAGCTGGTTGGTA[G/A]
CCAGCTTATGAGAATCTGGAAAAGCTAGGTTTCCCAGCTTCTGGCTTCTAGTTCATTTTTTGGATTCTAGAATTACAGCTTCTCAGAATCTGGACCAAAA

Reverse complement sequence

TTTTGGTCCAGATTCTGAGAAGCTGTAATTCTAGAATCCAAAAAATGAACTAGAAGCCAGAAGCTGGGAAACCTAGCTTTTCCAGATTCTCATAAGCTGG[C/T]
TACCAACCAGCTGCTTCTCAGAATCTTAAGCTCCCCCAAACAGGCCCAAATATCATATCGGTTGAACCTCTAGTGTATACTTGTATGAACCTCTTTGCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.10% 32.80% 0.15% 0.00% NA
All Indica  2759 55.40% 44.40% 0.25% 0.00% NA
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 30.90% 69.10% 0.00% 0.00% NA
Indica I  595 39.30% 60.20% 0.50% 0.00% NA
Indica II  465 28.80% 71.00% 0.22% 0.00% NA
Indica III  913 85.40% 14.60% 0.00% 0.00% NA
Indica Intermediate  786 48.30% 51.30% 0.38% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 63.30% 36.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217324261 G -> A LOC_Os02g29210.1 downstream_gene_variant ; 3304.0bp to feature; MODIFIER silent_mutation Average:51.578; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N
vg0217324261 G -> A LOC_Os02g29210.3 downstream_gene_variant ; 3331.0bp to feature; MODIFIER silent_mutation Average:51.578; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N
vg0217324261 G -> A LOC_Os02g29210.2 downstream_gene_variant ; 3331.0bp to feature; MODIFIER silent_mutation Average:51.578; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N
vg0217324261 G -> A LOC_Os02g29210.4 downstream_gene_variant ; 3331.0bp to feature; MODIFIER silent_mutation Average:51.578; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N
vg0217324261 G -> A LOC_Os02g29200-LOC_Os02g29210 intergenic_region ; MODIFIER silent_mutation Average:51.578; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217324261 NA 6.94E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 NA 4.37E-06 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 1.56E-06 NA mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 NA 4.66E-06 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 NA 2.64E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 2.38E-08 NA mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 5.70E-08 5.23E-10 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 NA 2.10E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 NA 3.44E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 8.88E-06 NA mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 NA 3.95E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 NA 9.14E-07 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 NA 3.54E-10 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 2.85E-14 1.33E-22 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 5.47E-10 4.69E-09 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 NA 5.14E-07 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 NA 7.09E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 2.50E-09 NA mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 4.80E-09 7.34E-09 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 NA 7.30E-14 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 NA 6.92E-06 mr1379_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 NA 4.70E-11 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 NA 5.11E-07 mr1559_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 5.15E-06 NA mr1585_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 5.88E-06 3.29E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 NA 5.34E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 5.38E-08 1.34E-10 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 7.25E-08 6.85E-08 mr1818_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 2.17E-15 1.72E-24 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 5.64E-09 1.56E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 2.19E-09 6.21E-14 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 3.30E-10 6.28E-09 mr1897_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 3.85E-10 NA mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 5.85E-09 2.12E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 4.49E-09 NA mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324261 1.64E-07 5.54E-06 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251