Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217029507:

Variant ID: vg0217029507 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17029507
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTTGAGTGCACTGCCACCATCGATGAGAGATCTGCGAAGCTTGATGTTGCGAACCACTGGGTCTAGTACCAGGGGGTACCGCCCCGGGTGGACCACTC[G/A]
GTCTGGATGATCCGAGCGGTTAAACTTAATTGTTGTCTCTGACCACCGAAGATATTGGGGCGTGTCGGGCTGAACAGCGTTGATCTCCCGTTCGGTCAGC

Reverse complement sequence

GCTGACCGAACGGGAGATCAACGCTGTTCAGCCCGACACGCCCCAATATCTTCGGTGGTCAGAGACAACAATTAAGTTTAACCGCTCGGATCATCCAGAC[C/T]
GAGTGGTCCACCCGGGGCGGTACCCCCTGGTACTAGACCCAGTGGTTCGCAACATCAAGCTTCGCAGATCTCTCATCGATGGTGGCAGTGCACTCAACAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.80% 17.10% 9.04% 18.07% NA
All Indica  2759 35.10% 22.70% 13.59% 28.67% NA
All Japonica  1512 98.70% 0.90% 0.26% 0.13% NA
Aus  269 41.30% 26.00% 14.13% 18.59% NA
Indica I  595 35.30% 22.70% 18.32% 23.70% NA
Indica II  465 24.70% 28.60% 15.48% 31.18% NA
Indica III  913 43.70% 16.20% 9.86% 30.23% NA
Indica Intermediate  786 31.00% 26.60% 13.23% 29.13% NA
Temperate Japonica  767 99.10% 0.50% 0.13% 0.26% NA
Tropical Japonica  504 99.00% 0.80% 0.20% 0.00% NA
Japonica Intermediate  241 96.70% 2.50% 0.83% 0.00% NA
VI/Aromatic  96 15.60% 80.20% 4.17% 0.00% NA
Intermediate  90 56.70% 24.40% 6.67% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217029507 G -> A LOC_Os02g28800.1 upstream_gene_variant ; 4327.0bp to feature; MODIFIER silent_mutation Average:57.962; most accessible tissue: Minghui63 flag leaf, score: 82.289 N N N N
vg0217029507 G -> A LOC_Os02g28770.1 downstream_gene_variant ; 4118.0bp to feature; MODIFIER silent_mutation Average:57.962; most accessible tissue: Minghui63 flag leaf, score: 82.289 N N N N
vg0217029507 G -> A LOC_Os02g28790.1 downstream_gene_variant ; 1741.0bp to feature; MODIFIER silent_mutation Average:57.962; most accessible tissue: Minghui63 flag leaf, score: 82.289 N N N N
vg0217029507 G -> A LOC_Os02g28780.1 intron_variant ; MODIFIER silent_mutation Average:57.962; most accessible tissue: Minghui63 flag leaf, score: 82.289 N N N N
vg0217029507 G -> DEL N N silent_mutation Average:57.962; most accessible tissue: Minghui63 flag leaf, score: 82.289 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0217029507 G A -0.02 -0.02 -0.01 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217029507 NA 1.07E-09 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217029507 NA 1.58E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217029507 NA 5.17E-06 mr1585 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217029507 1.66E-06 4.81E-20 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217029507 NA 7.35E-09 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217029507 3.47E-06 NA mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217029507 2.84E-07 1.37E-08 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217029507 NA 2.72E-08 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217029507 NA 1.41E-07 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217029507 NA 3.83E-07 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217029507 NA 4.75E-10 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217029507 NA 2.12E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217029507 NA 7.51E-24 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217029507 NA 9.15E-12 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217029507 3.49E-06 1.53E-13 mr1897_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217029507 NA 1.21E-08 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217029507 NA 3.13E-09 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217029507 3.67E-06 NA mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217029507 NA 8.93E-09 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251