| Variant ID: vg0216929890 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16929890 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.02, others allele: 0.00, population size: 63. )
ATATATATGTGACTAAATATTTTCAATTTTTTCACAAATTTTTTAAATAAGACGGACGGTCAAATGTTGGGCACGGATATCCACAGCTGCACTTATTTTG[G/A]
GACGGAGGTAGTATGTACCTAAAACTCGATGATAAGCCACCCTTGAAATCTATATCCAAATTCCTTGTTCCCTGCATCTTATTTATATGTGCTAGTCACT
AGTGACTAGCACATATAAATAAGATGCAGGGAACAAGGAATTTGGATATAGATTTCAAGGGTGGCTTATCATCGAGTTTTAGGTACATACTACCTCCGTC[C/T]
CAAAATAAGTGCAGCTGTGGATATCCGTGCCCAACATTTGACCGTCCGTCTTATTTAAAAAATTTGTGAAAAAATTGAAAATATTTAGTCACATATATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.50% | 25.20% | 0.38% | 0.00% | NA |
| All Indica | 2759 | 74.80% | 24.60% | 0.51% | 0.00% | NA |
| All Japonica | 1512 | 75.20% | 24.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 60.60% | 39.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 66.90% | 32.30% | 0.84% | 0.00% | NA |
| Indica II | 465 | 88.80% | 10.80% | 0.43% | 0.00% | NA |
| Indica III | 913 | 72.90% | 26.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 74.80% | 24.60% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 39.90% | 60.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.60% | 17.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 30.00% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216929890 | G -> A | LOC_Os02g28610.1 | upstream_gene_variant ; 1077.0bp to feature; MODIFIER | silent_mutation | Average:41.012; most accessible tissue: Zhenshan97 flower, score: 58.632 | N | N | N | N |
| vg0216929890 | G -> A | LOC_Os02g28600.1 | downstream_gene_variant ; 4515.0bp to feature; MODIFIER | silent_mutation | Average:41.012; most accessible tissue: Zhenshan97 flower, score: 58.632 | N | N | N | N |
| vg0216929890 | G -> A | LOC_Os02g28620.1 | downstream_gene_variant ; 4584.0bp to feature; MODIFIER | silent_mutation | Average:41.012; most accessible tissue: Zhenshan97 flower, score: 58.632 | N | N | N | N |
| vg0216929890 | G -> A | LOC_Os02g28600-LOC_Os02g28610 | intergenic_region ; MODIFIER | silent_mutation | Average:41.012; most accessible tissue: Zhenshan97 flower, score: 58.632 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216929890 | NA | 4.71E-06 | mr1039 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216929890 | NA | 6.71E-06 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216929890 | NA | 7.37E-13 | mr1093 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216929890 | 1.44E-08 | NA | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216929890 | 6.29E-10 | 1.09E-10 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216929890 | 2.23E-08 | 7.63E-10 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216929890 | NA | 1.50E-14 | mr1235 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216929890 | NA | 3.71E-09 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216929890 | NA | 3.19E-08 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216929890 | NA | 2.32E-08 | mr1243 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/