Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216764706:

Variant ID: vg0216764706 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16764706
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

CGAGCTCTCGTGTTGTGCATATTTGGTTTGATAGGCAGTGGGCATACTCGCATACTCGCATACGTAGTAGCCGCATAAGTTAGTTCCCTGGTCCTGCTTT[G/A]
CACACTACATGAGAAACGATGAGAGATTTAATATACTCTTTATATTAACTGTAATTAGAGATTCAATTCAATATAATTTTGGATCATGCATGTACTCACT

Reverse complement sequence

AGTGAGTACATGCATGATCCAAAATTATATTGAATTGAATCTCTAATTACAGTTAATATAAAGAGTATATTAAATCTCTCATCGTTTCTCATGTAGTGTG[C/T]
AAAGCAGGACCAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTATGCGAGTATGCCCACTGCCTATCAAACCAAATATGCACAACACGAGAGCTCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.30%	33.20%	9.84%	0.66%	NA
All Indica	2759	35.10%	48.30%	15.51%	1.12%	NA
All Japonica	1512	98.50%	1.30%	0.20%	0.00%	NA
Aus	269	51.70%	38.70%	9.67%	0.00%	NA
Indica I	595	39.50%	36.60%	22.52%	1.34%	NA
Indica II	465	23.00%	50.10%	24.30%	2.58%	NA
Indica III	913	40.90%	53.60%	5.37%	0.22%	NA
Indica Intermediate	786	32.20%	49.90%	16.79%	1.15%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.40%	0.20%	0.00%	NA
Japonica Intermediate	241	96.70%	2.50%	0.83%	0.00%	NA
VI/Aromatic	96	6.20%	91.70%	2.08%	0.00%	NA
Intermediate	90	63.30%	30.00%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216764706	G -> A	LOC_Os02g28350.1	downstream_gene_variant ; 4261.0bp to feature; MODIFIER	silent_mutation	Average:26.838; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0216764706	G -> A	LOC_Os02g28360.1	downstream_gene_variant ; 2029.0bp to feature; MODIFIER	silent_mutation	Average:26.838; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0216764706	G -> A	LOC_Os02g28370.1	downstream_gene_variant ; 1182.0bp to feature; MODIFIER	silent_mutation	Average:26.838; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0216764706	G -> A	LOC_Os02g28360-LOC_Os02g28370	intergenic_region ; MODIFIER	silent_mutation	Average:26.838; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0216764706	G -> DEL	N	N	silent_mutation	Average:26.838; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216764706	NA	2.21E-07	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706	7.02E-07	1.03E-08	mr1317	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706	NA	4.34E-07	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706	NA	9.54E-11	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706	1.92E-06	7.21E-08	mr1317_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706	NA	7.00E-12	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706	NA	7.37E-11	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706	NA	2.51E-06	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706	NA	2.44E-07	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706	NA	1.08E-06	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706	NA	6.25E-07	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251