Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216714909:

Variant ID: vg0216714909 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16714909
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CCACCGGCTTTGTGTATGTTCCTTGCAATCGGAGCATGCCTTCTTTCCTTTTATAGTTTGTCCGGAAATATTACCGAGTGTAGGGTAGTCATTAATGGTG[C/T]
AGAACAATAGAACTCTTAGCTTGAAGTTCTCCTGACCATATGTATCCCAAGTTTCCACACCTTCTTTCCAAAGAATCTCCAGATCGTCGATAATAGGCTC

Reverse complement sequence

GAGCCTATTATCGACGATCTGGAGATTCTTTGGAAAGAAGGTGTGGAAACTTGGGATACATATGGTCAGGAGAACTTCAAGCTAAGAGTTCTATTGTTCT[G/A]
CACCATTAATGACTACCCTACACTCGGTAATATTTCCGGACAAACTATAAAAGGAAAGAAGGCATGCTCCGATTGCAAGGAACATACACAAAGCCGGTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.50% 13.40% 0.06% 0.00% NA
All Indica  2759 81.90% 17.90% 0.11% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 54.30% 45.70% 0.00% 0.00% NA
Indica I  595 78.20% 21.80% 0.00% 0.00% NA
Indica II  465 73.30% 26.50% 0.22% 0.00% NA
Indica III  913 87.00% 12.90% 0.11% 0.00% NA
Indica Intermediate  786 84.10% 15.80% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216714909 C -> T LOC_Os02g28260.1 missense_variant ; p.Cys152Tyr; MODERATE nonsynonymous_codon ; C152Y Average:25.153; most accessible tissue: Minghui63 flag leaf, score: 51.386 benign 0.411 DELETERIOUS 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216714909 NA 4.00E-07 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 NA 4.51E-08 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 NA 5.32E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 1.89E-11 8.49E-27 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 1.83E-10 6.65E-26 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 NA 6.07E-08 mr1350 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 NA 7.72E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 NA 2.93E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 NA 1.90E-06 mr1585 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 NA 4.03E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 1.62E-07 5.88E-09 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 4.38E-08 3.54E-09 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 NA 7.07E-06 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 NA 7.55E-06 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 2.14E-08 5.23E-14 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 7.49E-14 5.26E-72 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 9.32E-11 4.30E-47 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 6.65E-06 2.49E-14 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 NA 7.55E-08 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 9.76E-08 4.32E-13 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 8.14E-07 1.90E-11 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 1.48E-09 5.55E-15 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 1.98E-08 9.75E-12 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 NA 2.83E-12 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 NA 7.36E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 NA 5.69E-07 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 NA 1.31E-09 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 NA 3.59E-10 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 8.72E-12 3.89E-34 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 2.13E-10 2.06E-32 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 1.70E-07 3.10E-12 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 5.49E-06 NA mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 NA 6.33E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 4.66E-08 2.50E-10 mr1559_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 NA 5.34E-06 mr1585_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 7.07E-09 4.86E-20 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 8.74E-08 2.45E-14 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 9.03E-08 5.50E-21 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 4.14E-08 1.71E-17 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 3.45E-06 NA mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 NA 8.66E-07 mr1649_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 9.12E-10 4.07E-30 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 7.84E-10 2.00E-22 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 7.56E-22 1.05E-90 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 2.93E-17 1.46E-58 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 6.86E-11 3.80E-29 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 6.32E-10 2.32E-23 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 8.36E-13 3.50E-38 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 4.18E-11 3.68E-38 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 7.37E-10 7.08E-34 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714909 8.28E-08 1.54E-27 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251