Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216594873:

Variant ID: vg0216594873 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16594873
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGACGCTATCAACCCCTCAACGGAGTATTCCTGTCTCTTGTATTTGAGTGCAGTACTGAAACCTCTCCAAGATGGAGGTTGTTTCGCGATAATGCACC[C/T]
GGCCACAAATTTGTCGGGTAAGACACACTTAAGGAGTTCGAGTTCCTTAGCCATGGTTTGTATCTCATGAGCCTGTTCGACTATAGAACAGTTGTCAGCC

Reverse complement sequence

GGCTGACAACTGTTCTATAGTCGAACAGGCTCATGAGATACAAACCATGGCTAAGGAACTCGAACTCCTTAAGTGTGTCTTACCCGACAAATTTGTGGCC[G/A]
GGTGCATTATCGCGAAACAACCTCCATCTTGGAGAGGTTTCAGTACTGCACTCAAATACAAGAGACAGGAATACTCCGTTGAGGGGTTGATAGCGTCTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.00%	0.40%	5.95%	56.58%	NA
All Indica	2759	15.00%	0.70%	9.39%	74.99%	NA
All Japonica	1512	77.60%	0.00%	0.33%	22.09%	NA
Aus	269	11.20%	0.70%	5.20%	82.90%	NA
Indica I	595	9.40%	1.50%	4.54%	84.54%	NA
Indica II	465	14.80%	0.90%	5.59%	78.71%	NA
Indica III	913	20.70%	0.10%	15.66%	63.53%	NA
Indica Intermediate	786	12.60%	0.50%	8.02%	78.88%	NA
Temperate Japonica	767	95.80%	0.00%	0.00%	4.17%	NA
Tropical Japonica	504	47.00%	0.00%	0.79%	52.18%	NA
Japonica Intermediate	241	83.40%	0.00%	0.41%	16.18%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	45.60%	1.10%	3.33%	50.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216594873	C -> T	LOC_Os02g28020.1	missense_variant ; p.Gly117Arg; MODERATE	nonsynonymous_codon ; G117R	Average:43.292; most accessible tissue: Minghui63 young leaf, score: 70.655	benign	0.872	DELETERIOUS	0.02
vg0216594873	C -> DEL	LOC_Os02g28020.1	N	frameshift_variant	Average:43.292; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216594873	NA	7.17E-06	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873	7.97E-07	NA	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873	4.09E-08	9.58E-11	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873	NA	9.84E-10	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873	NA	6.51E-13	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873	NA	2.30E-06	mr1559	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873	4.44E-06	NA	mr1610	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873	2.77E-06	6.49E-07	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873	7.24E-08	4.87E-18	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873	1.20E-06	1.33E-09	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873	NA	2.46E-07	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873	1.84E-06	2.93E-16	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873	NA	2.48E-08	mr1379_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873	2.66E-06	7.08E-15	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873	NA	2.01E-09	mr1559_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873	NA	6.80E-06	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873	NA	3.73E-08	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873	NA	5.99E-06	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251