Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216379915:

Variant ID: vg0216379915 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16379915
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACATAAGCTTCAACGTTGCGGCCGATCTGAGTCAAAAAACATCTCTGGATCATGCGTTGGTAAGTTGCTCCTGCATTCTTCAATCCGAAAGGCATAGTG[A/G]
TATAGCAGTAGGCCCCAAAGGGCGTGATGAATGAAGTCTTCAAGCAGTCGGATTCCTTCAGTCGGATCTGATGATATCCCGAGTAGCAATCCAAAAAACT

Reverse complement sequence

AGTTTTTTGGATTGCTACTCGGGATATCATCAGATCCGACTGAAGGAATCCGACTGCTTGAAGACTTCATTCATCACGCCCTTTGGGGCCTACTGCTATA[T/C]
CACTATGCCTTTCGGATTGAAGAATGCAGGAGCAACTTACCAACGCATGATCCAGAGATGTTTTTTGACTCAGATCGGCCGCAACGTTGAAGCTTATGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.70% 7.60% 3.58% 0.06% NA
All Indica  2759 83.40% 12.20% 4.28% 0.11% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 77.70% 4.80% 17.47% 0.00% NA
Indica I  595 79.80% 12.30% 7.90% 0.00% NA
Indica II  465 73.10% 24.10% 2.80% 0.00% NA
Indica III  913 90.10% 8.10% 1.53% 0.22% NA
Indica Intermediate  786 84.50% 9.80% 5.60% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 0.00% 2.08% 0.00% NA
Intermediate  90 91.10% 6.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216379915 A -> G LOC_Os02g27640.1 missense_variant ; p.Ile69Thr; MODERATE nonsynonymous_codon ; I69T Average:39.959; most accessible tissue: Minghui63 panicle, score: 64.459 benign 0.445 TOLERATED 0.41
vg0216379915 A -> DEL LOC_Os02g27640.1 N frameshift_variant Average:39.959; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216379915 NA 6.50E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 7.99E-06 NA mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 NA 3.45E-08 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 7.72E-07 7.72E-07 mr1184 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 NA 3.07E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 3.46E-08 3.72E-15 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 1.61E-08 5.03E-18 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 7.39E-06 NA mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 8.48E-06 1.16E-07 mr1350 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 NA 2.32E-06 mr1549 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 NA 5.52E-06 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 3.16E-06 1.05E-10 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 2.69E-12 2.04E-39 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 7.81E-15 2.22E-34 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 3.01E-06 3.01E-06 mr1883 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 4.42E-06 8.48E-09 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 NA 2.09E-07 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 2.20E-06 3.39E-07 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 NA 4.80E-09 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 1.21E-06 9.03E-10 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 7.62E-08 1.63E-08 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 NA 1.84E-07 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 6.94E-06 4.61E-08 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 7.54E-07 6.79E-10 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 2.83E-11 5.29E-22 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 1.31E-15 1.08E-28 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 NA 2.41E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 6.85E-08 1.35E-08 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 NA 7.47E-11 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 1.37E-06 2.76E-11 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 3.47E-09 3.32E-14 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 9.52E-11 2.10E-16 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 2.17E-09 3.87E-19 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 1.16E-13 2.69E-21 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 3.92E-14 9.85E-43 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 2.10E-13 5.37E-37 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 8.31E-10 4.81E-19 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 4.90E-12 2.43E-19 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 2.47E-09 1.01E-18 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 2.62E-12 1.01E-24 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 1.01E-08 1.01E-17 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216379915 7.98E-10 1.04E-20 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251