RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0216159752:

Variant ID: vg0216159752 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16159752
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

AGGACTTCACCAGGCAACCAGTGATGCGAAGAAGGATGCACCTGGTGGCAACTATGCACATTTTGTTCATATTAGATAGGTTTGTATAGCACTTATCCCT[A/G]
GTATTGTCATGTACTGAAGTTGAACAATGCACATGTCATGCCAAAAACTATGCCCTTTTGGATAGAACAGATAGGCCAACATGCCAATACTTCTGCTAGA

Reverse complement sequence

TCTAGCAGAAGTATTGGCATGTTGGCCTATCTGTTCTATCCAAAAGGGCATAGTTTTTGGCATGACATGTGCATTGTTCAACTTCAGTACATGACAATAC[T/C]
AGGGATAAGTGCTATACAAACCTATCTAATATGAACAAAATGTGCATAGTTGCCACCAGGTGCATCCTTCTTCGCATCACTGGTTGCCTGGTGAAGTCCT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.40%	38.00%	2.50%	0.04%	NA
All Indica	2759	86.30%	9.60%	3.99%	0.07%	NA
All Japonica	1512	2.00%	98.00%	0.00%	0.00%	NA
Aus	269	98.50%	0.00%	1.49%	0.00%	NA
Indica I	595	89.60%	2.00%	8.40%	0.00%	NA
Indica II	465	86.50%	12.70%	0.65%	0.22%	NA
Indica III	913	83.70%	14.80%	1.53%	0.00%	NA
Indica Intermediate	786	86.90%	7.50%	5.47%	0.13%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	2.60%	97.40%	0.00%	0.00%	NA
Japonica Intermediate	241	4.10%	95.90%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	52.20%	43.30%	4.44%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216159752	A -> G	LOC_Os02g27430.1	downstream_gene_variant ; 713.0bp to feature; MODIFIER	silent_mutation	Average:50.09; most accessible tissue: Zhenshan97 young leaf, score: 64.205	N	N	N	N
vg0216159752	A -> G	LOC_Os02g27420.1	intron_variant ; MODIFIER	silent_mutation	Average:50.09; most accessible tissue: Zhenshan97 young leaf, score: 64.205	N	N	N	N
vg0216159752	A -> DEL	N	N	silent_mutation	Average:50.09; most accessible tissue: Zhenshan97 young leaf, score: 64.205	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216159752	1.10E-07	4.08E-09	Awn_length	Ind_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0216159752	NA	3.10E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0216159752	NA	2.77E-46	mr1016	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216159752	NA	1.11E-15	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216159752	NA	6.72E-14	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216159752	NA	1.95E-27	mr1022	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216159752	NA	1.46E-16	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216159752	NA	5.51E-10	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216159752	NA	4.49E-15	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216159752	NA	1.27E-17	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 89 entries

Previous1 2 3 4 5…9Next

Search for Variation information by Variation ID:

Detailed information for vg0216159752:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact