Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216121609:

Variant ID: vg0216121609 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16121609
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

AATGTTGACAAGGCTCCACGCAGACTCTACGCCTTCTCGATCGCTCAAGAACGGTTGCTGGATCTCGACAAGGAATACAGAATGAAAAGATGGTGTACCC[G/A]
CCGAGATAAAATTTCTTGACTTCAATCCAAATTCTCGATTACAGCAAGACGGGAGACTTAGTCGTCTGCTCTGTACTTCCTTGGTTGACATCGGAGATTG

Reverse complement sequence

CAATCTCCGATGTCAACCAAGGAAGTACAGAGCAGACGACTAAGTCTCCCGTCTTGCTGTAATCGAGAATTTGGATTGAAGTCAAGAAATTTTATCTCGG[C/T]
GGGTACACCATCTTTTCATTCTGTATTCCTTGTCGAGATCCAGCAACCGTTCTTGAGCGATCGAGAAGGCGTAGAGTCTGCGTGGAGCCTTGTCAACATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.30%	7.70%	0.02%	0.00%	NA
All Indica	2759	90.10%	9.90%	0.00%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	69.50%	30.10%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	75.30%	24.70%	0.00%	0.00%	NA
Indica III	913	91.70%	8.30%	0.00%	0.00%	NA
Indica Intermediate	786	89.60%	10.40%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216121609	G -> A	LOC_Os02g27360.1	upstream_gene_variant ; 1169.0bp to feature; MODIFIER	silent_mutation	Average:55.259; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg0216121609	G -> A	LOC_Os02g27360.2	upstream_gene_variant ; 1170.0bp to feature; MODIFIER	silent_mutation	Average:55.259; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg0216121609	G -> A	LOC_Os02g27360-LOC_Os02g27370	intergenic_region ; MODIFIER	silent_mutation	Average:55.259; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216121609	NA	3.26E-06	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	1.80E-06	4.16E-14	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	1.17E-06	2.02E-11	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	NA	2.79E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	NA	1.90E-06	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	9.88E-12	2.81E-38	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	9.58E-11	1.09E-22	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	NA	1.49E-06	mr1914	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	NA	7.64E-06	mr1253_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	3.90E-07	5.18E-17	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	3.30E-07	2.65E-13	mr1317_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	NA	8.88E-09	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	NA	7.89E-12	mr1610_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	6.60E-06	2.04E-09	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	NA	3.17E-12	mr1818_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	NA	3.10E-08	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	1.82E-07	1.82E-30	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	8.52E-07	1.65E-15	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	NA	1.18E-14	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	NA	9.42E-10	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	4.99E-06	2.63E-16	mr1914_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	NA	1.23E-12	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	NA	2.77E-09	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251