Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216078062:

Variant ID: vg0216078062 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16078062
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

GGAATAATGCCATATGTACATTTTGTAACACCATGATAACTCTTTGTGGGGACCACTATTCTCTAGAGCAACCAACCAAGCACTCAAGATTGCTTCTCGA[T/A]
TTTCCAAGATCTCTGGGATAATCTAGCTTCTATTGGCTATTACATACGAACTTATCTTACACTCACTATTAGAGTAGGTACAATAAAGATAGTGAGCGTA

Reverse complement sequence

TACGCTCACTATCTTTATTGTACCTACTCTAATAGTGAGTGTAAGATAAGTTCGTATGTAATAGCCAATAGAAGCTAGATTATCCCAGAGATCTTGGAAA[A/T]
TCGAGAAGCAATCTTGAGTGCTTGGTTGGTTGCTCTAGAGAATAGTGGTCCCCACAAAGAGTTATCATGGTGTTACAAAATGTACATATGGCATTATTCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.90%	6.50%	0.59%	0.00%	NA
All Indica	2759	97.60%	2.40%	0.00%	0.00%	NA
All Japonica	1512	83.70%	14.60%	1.72%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	92.00%	8.00%	0.00%	0.00%	NA
Indica III	913	97.70%	2.30%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	1.10%	0.00%	0.00%	NA
Temperate Japonica	767	97.30%	2.10%	0.65%	0.00%	NA
Tropical Japonica	504	77.80%	20.60%	1.59%	0.00%	NA
Japonica Intermediate	241	52.70%	41.90%	5.39%	0.00%	NA
VI/Aromatic	96	86.50%	12.50%	1.04%	0.00%	NA
Intermediate	90	91.10%	7.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216078062	T -> A	LOC_Os02g27300.1	upstream_gene_variant ; 4514.0bp to feature; MODIFIER	silent_mutation	Average:41.017; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg0216078062	T -> A	LOC_Os02g27290.1	downstream_gene_variant ; 3442.0bp to feature; MODIFIER	silent_mutation	Average:41.017; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg0216078062	T -> A	LOC_Os02g27290-LOC_Os02g27300	intergenic_region ; MODIFIER	silent_mutation	Average:41.017; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216078062	NA	8.29E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216078062	NA	8.36E-11	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216078062	NA	2.57E-07	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216078062	NA	3.95E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216078062	NA	2.38E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216078062	NA	7.24E-07	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216078062	2.33E-07	3.27E-14	mr1691_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216078062	NA	7.44E-08	mr1691_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251