Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0214392322:

Variant ID: vg0214392322 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 14392322
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, C: 0.39, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


GAACGTTGCCGCCGCTCGTTATGGCAGCGGCAGCAGCAGCGTCAGACGCCTCCTTGGCGACTTTCTCCTTCAGCGACGCCGCCACCAGATGGTCCACAAG[T/C]
GGCTCGATGATATCAGTCAGAGGGAGAGCCTACGCTTCATGAAGTCATAATGCGATCCCGGAAGAAAAATGCAAAAGGACCGCTGAGTACACTTACATTG

Reverse complement sequence

CAATGTAAGTGTACTCAGCGGTCCTTTTGCATTTTTCTTCCGGGATCGCATTATGACTTCATGAAGCGTAGGCTCTCCCTCTGACTGATATCATCGAGCC[A/G]
CTTGTGGACCATCTGGTGGCGGCGTCGCTGAAGGAGAAAGTCGCCAAGGAGGCGTCTGACGCTGCTGCTGCCGCTGCCATAACGAGCGGCGGCAACGTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 42.10% 1.95% 0.04% NA
All Indica  2759 83.10% 13.70% 3.04% 0.07% NA
All Japonica  1512 1.50% 98.40% 0.07% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 94.80% 0.20% 5.04% 0.00% NA
Indica II  465 66.70% 28.20% 5.16% 0.00% NA
Indica III  913 80.50% 18.90% 0.55% 0.00% NA
Indica Intermediate  786 87.20% 9.40% 3.18% 0.25% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.10% 0.41% 0.00% NA
VI/Aromatic  96 25.00% 74.00% 1.04% 0.00% NA
Intermediate  90 38.90% 55.60% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0214392322 T -> DEL LOC_Os02g24800.1 N frameshift_variant Average:57.362; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0214392322 T -> C LOC_Os02g24800.1 synonymous_variant ; p.Pro246Pro; LOW synonymous_codon Average:57.362; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0214392322 NA 1.54E-36 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 5.55E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 2.54E-34 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 7.23E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 5.97E-33 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 4.24E-07 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 4.87E-15 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 1.52E-31 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 1.65E-22 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 1.08E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 2.48E-09 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 4.76E-24 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 1.01E-10 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 2.08E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 2.41E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 1.91E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 4.42E-06 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 1.19E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 3.88E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 8.84E-07 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 1.21E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 5.66E-12 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 1.48E-08 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 3.85E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 2.90E-30 mr1074_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 1.86E-32 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 4.80E-20 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 8.16E-17 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 1.42E-16 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 2.20E-26 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 1.56E-34 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 2.06E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 1.89E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 1.87E-33 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 2.50E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 2.60E-27 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 5.54E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 3.43E-10 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214392322 NA 9.45E-07 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251