Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0214216570:

Variant ID: vg0214216570 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 14216570
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAAGGCCCTGAACCCACACGAACCTGGCTTAACCCAAGGCCTATGATGATTCAGACCAAACTGGCAACCCGACCTAGGTCCCAGCTCGTCCCAAGCCAA[C/T]
CTAGGCCAACCATTCCACATTTTAGTTGTTAAGCAAGTTTTAAGAATTAAACCACTAACTTGGGTACATTGCTAGGCTTGCCCATAACCGAGGGCGCGGC

Reverse complement sequence

GCCGCGCCCTCGGTTATGGGCAAGCCTAGCAATGTACCCAAGTTAGTGGTTTAATTCTTAAAACTTGCTTAACAACTAAAATGTGGAATGGTTGGCCTAG[G/A]
TTGGCTTGGGACGAGCTGGGACCTAGGTCGGGTTGCCAGTTTGGTCTGAATCATCATAGGCCTTGGGTTAAGCCAGGTTCGTGTGGGTTCAGGGCCTTGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.20%	0.30%	2.14%	23.30%	NA
All Indica	2759	58.20%	0.60%	3.41%	37.80%	NA
All Japonica	1512	99.30%	0.00%	0.07%	0.66%	NA
Aus	269	86.20%	0.00%	2.23%	11.52%	NA
Indica I	595	50.30%	0.00%	1.51%	48.24%	NA
Indica II	465	56.10%	0.00%	3.44%	40.43%	NA
Indica III	913	66.50%	1.10%	4.82%	27.60%	NA
Indica Intermediate	786	55.90%	0.80%	3.18%	40.20%	NA
Temperate Japonica	767	99.50%	0.00%	0.13%	0.39%	NA
Tropical Japonica	504	98.60%	0.00%	0.00%	1.39%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	83.30%	0.00%	0.00%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0214216570	C -> T	LOC_Os02g24520.1	upstream_gene_variant ; 3791.0bp to feature; MODIFIER	silent_mutation	Average:17.204; most accessible tissue: Callus, score: 40.907	N	N	N	N
vg0214216570	C -> T	LOC_Os02g24530.1	upstream_gene_variant ; 1119.0bp to feature; MODIFIER	silent_mutation	Average:17.204; most accessible tissue: Callus, score: 40.907	N	N	N	N
vg0214216570	C -> T	LOC_Os02g24540.1	downstream_gene_variant ; 3495.0bp to feature; MODIFIER	silent_mutation	Average:17.204; most accessible tissue: Callus, score: 40.907	N	N	N	N
vg0214216570	C -> T	LOC_Os02g24530-LOC_Os02g24540	intergenic_region ; MODIFIER	silent_mutation	Average:17.204; most accessible tissue: Callus, score: 40.907	N	N	N	N
vg0214216570	C -> DEL	N	N	silent_mutation	Average:17.204; most accessible tissue: Callus, score: 40.907	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0214216570	7.86E-07	NA	mr1098_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214216570	1.12E-06	NA	mr1150_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214216570	2.04E-06	2.04E-06	mr1292_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214216570	9.67E-06	NA	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251