Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0214178491:

Variant ID: vg0214178491 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 14178491
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

CTAGGGCAAGCACGACCTGGATGTGACGCCGCACGTCGGGCGCTTCGGTCTTCACCCGGCCAACACAGCCCGACTACGCTGCTTCCGCCGCGGGCTCGGG[A/G]
GTTTCGCCTTTGTGCGCCGCCGCCTCATCCGCTGCCAACTGATGTTTCCGCCTGCACGGTTGGCCTATTATGCCATCGTCCATGGGCGTCCACATCTTCA

Reverse complement sequence

TGAAGATGTGGACGCCCATGGACGATGGCATAATAGGCCAACCGTGCAGGCGGAAACATCAGTTGGCAGCGGATGAGGCGGCGGCGCACAAAGGCGAAAC[T/C]
CCCGAGCCCGCGGCGGAAGCAGCGTAGTCGGGCTGTGTTGGCCGGGTGAAGACCGAAGCGCCCGACGTGCGGCGTCACATCCAGGTCGTGCTTGCCCTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.10%	38.40%	3.26%	7.24%	NA
All Indica	2759	81.00%	4.00%	5.04%	10.00%	NA
All Japonica	1512	0.70%	98.40%	0.00%	0.86%	NA
Aus	269	53.20%	26.40%	4.83%	15.61%	NA
Indica I	595	83.20%	1.00%	6.39%	9.41%	NA
Indica II	465	82.80%	3.90%	3.87%	9.46%	NA
Indica III	913	81.30%	3.50%	4.82%	10.41%	NA
Indica Intermediate	786	77.90%	6.90%	4.96%	10.31%	NA
Temperate Japonica	767	0.40%	99.10%	0.00%	0.52%	NA
Tropical Japonica	504	0.80%	97.60%	0.00%	1.59%	NA
Japonica Intermediate	241	1.70%	97.90%	0.00%	0.41%	NA
VI/Aromatic	96	2.10%	96.90%	1.04%	0.00%	NA
Intermediate	90	27.80%	58.90%	1.11%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0214178491	A -> G	LOC_Os02g24460.1	upstream_gene_variant ; 4332.0bp to feature; MODIFIER	silent_mutation	Average:30.262; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0214178491	A -> G	LOC_Os02g24480.1	upstream_gene_variant ; 82.0bp to feature; MODIFIER	silent_mutation	Average:30.262; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0214178491	A -> G	LOC_Os02g24470.1	downstream_gene_variant ; 1903.0bp to feature; MODIFIER	silent_mutation	Average:30.262; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0214178491	A -> G	LOC_Os02g24470-LOC_Os02g24480	intergenic_region ; MODIFIER	silent_mutation	Average:30.262; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0214178491	A -> DEL	N	N	silent_mutation	Average:30.262; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0214178491	NA	9.97E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178491	NA	2.23E-09	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178491	2.12E-06	NA	mr1445_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178491	5.10E-06	4.21E-06	mr1445_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178491	NA	4.80E-09	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178491	NA	6.37E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178491	NA	4.39E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178491	NA	9.14E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178491	NA	2.09E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251