Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0214173791:

Variant ID: vg0214173791 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 14173791
Reference Allele: TGG	Alternative Allele: CGG,T
Primary Allele: CGG	Secondary Allele: TGG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACAAACATGATATAAAAGACACATCTTTATTATATCGATAATATTTACATTATTACAAAGGCACTTCAGGCCTATGGCTCCATCTTCACAGGCGCTCAAC[TGG/CGG,T]
GGTATAAGCCATGGCTCCACCTAAACTTCTTCTCCAAAGCTTTACTGAAGGGGGTGAAAGATAGAGCAAGAATGAGTACAACCACAGTACTCAGCAAGTC

Reverse complement sequence

GACTTGCTGAGTACTGTGGTTGTACTCATTCTTGCTCTATCTTTCACCCCCTTCAGTAAAGCTTTGGAGAAGAAGTTTAGGTGGAGCCATGGCTTATACC[CCA/CCG,A]
GTTGAGCGCCTGTGAAGATGGAGCCATAGGCCTGAAGTGCCTTTGTAATAATGTAAATATTATCGATATAATAAAGATGTGTCTTTTATATCATGTTTGT

Allele Frequencies:

Populations	Population Size	Frequency of CGG(primary allele)	Frequency of TGG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.80%	37.50%	0.17%	0.15%	T: 0.42%
All Indica	2759	96.10%	2.80%	0.22%	0.14%	T: 0.72%
All Japonica	1512	1.70%	98.30%	0.07%	0.00%	NA
Aus	269	75.10%	24.90%	0.00%	0.00%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	96.80%	2.80%	0.22%	0.22%	NA
Indica III	913	95.40%	2.50%	0.22%	0.11%	T: 1.75%
Indica Intermediate	786	93.90%	5.10%	0.25%	0.25%	T: 0.51%
Temperate Japonica	767	1.00%	99.00%	0.00%	0.00%	NA
Tropical Japonica	504	2.40%	97.40%	0.20%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	95.80%	0.00%	1.04%	NA
Intermediate	90	43.30%	53.30%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0214173791	TGG -> CGG	LOC_Os02g24470.1	upstream_gene_variant ; 2324.0bp to feature; MODIFIER	silent_mutation	Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0214173791	TGG -> CGG	LOC_Os02g24480.1	upstream_gene_variant ; 4782.0bp to feature; MODIFIER	silent_mutation	Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0214173791	TGG -> CGG	LOC_Os02g24430.2	downstream_gene_variant ; 2009.0bp to feature; MODIFIER	silent_mutation	Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0214173791	TGG -> CGG	LOC_Os02g24460.1	intron_variant ; MODIFIER	silent_mutation	Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0214173791	TGG -> T	LOC_Os02g24470.1	upstream_gene_variant ; 2323.0bp to feature; MODIFIER	silent_mutation	Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0214173791	TGG -> T	LOC_Os02g24480.1	upstream_gene_variant ; 4781.0bp to feature; MODIFIER	silent_mutation	Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0214173791	TGG -> T	LOC_Os02g24430.2	downstream_gene_variant ; 2010.0bp to feature; MODIFIER	silent_mutation	Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0214173791	TGG -> T	LOC_Os02g24460.1	intron_variant ; MODIFIER	silent_mutation	Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0214173791	TGG -> DEL	N	N	silent_mutation	Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0214173791	NA	3.19E-17	mr1199_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214173791	5.65E-07	2.19E-06	mr1622_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214173791	NA	1.45E-07	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214173791	NA	2.72E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214173791	NA	1.59E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251