Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0212145917:

Variant ID: vg0212145917 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 12145917
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCTGGACAAAAATACACTCCACAATTCTACTACCATTAATTAAGTGTGGTGGTAGTTAGAAGTAGATCTAAACTCTTCAATCAAATAAGATCAACAGT[A/T]
TATATTACTTTCTACCATAGGTACAGTGCATAGTAGGGAGCACCGGAGTGGGACTCCTGTATATATGGTTCTCTTTGCTGTTGAGAAATCGTTGATCTTA

Reverse complement sequence

TAAGATCAACGATTTCTCAACAGCAAAGAGAACCATATATACAGGAGTCCCACTCCGGTGCTCCCTACTATGCACTGTACCTATGGTAGAAAGTAATATA[T/A]
ACTGTTGATCTTATTTGATTGAAGAGTTTAGATCTACTTCTAACTACCACCACACTTAATTAATGGTAGTAGAATTGTGGAGTGTATTTTTGTCCAGGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 8.50% 1.59% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 69.20% 25.90% 4.89% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 45.80% 48.10% 6.13% 0.00% NA
Tropical Japonica  504 95.00% 1.80% 3.17% 0.00% NA
Japonica Intermediate  241 89.60% 5.80% 4.56% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0212145917 A -> T LOC_Os02g20590.1 upstream_gene_variant ; 1760.0bp to feature; MODIFIER silent_mutation Average:75.648; most accessible tissue: Zhenshan97 panicle, score: 88.625 N N N N
vg0212145917 A -> T LOC_Os02g20600.1 downstream_gene_variant ; 476.0bp to feature; MODIFIER silent_mutation Average:75.648; most accessible tissue: Zhenshan97 panicle, score: 88.625 N N N N
vg0212145917 A -> T LOC_Os02g20590-LOC_Os02g20600 intergenic_region ; MODIFIER silent_mutation Average:75.648; most accessible tissue: Zhenshan97 panicle, score: 88.625 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0212145917 NA 1.91E-10 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 2.13E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 1.21E-06 mr1162 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 2.11E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 2.13E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 8.42E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 2.86E-06 NA mr1320 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 4.60E-07 4.60E-07 mr1320 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 2.85E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 2.83E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 2.50E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 7.82E-08 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 8.19E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 2.55E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 1.90E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 9.86E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 2.99E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 2.28E-06 2.28E-06 mr1630 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 1.21E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 5.14E-08 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 4.50E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 3.01E-09 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 1.03E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 2.86E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 6.05E-07 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 2.15E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 1.39E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 5.46E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 1.48E-06 4.47E-10 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 2.01E-07 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 1.32E-09 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 3.86E-06 mr1748_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 1.72E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 4.39E-10 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212145917 NA 1.75E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251