Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0212112209:

Variant ID: vg0212112209 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 12112209
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.30, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

TCATCTGCTCGTGTTCACCACCAGAGCTCGCCAATGCCATTTCTCTCTCTATCAGGGCCACGTCGTTGCCGGCCATGTTCCTGTTGTTCTGGTTTTCTTC[G/A]
TTGCCCGAGCACCGATGCCCATCTTTATTATGATGAGAATATGAGTATATCAATATGCAATACTGGTTTTCATCCATCCTAATTATCATTTAAATTTGTG

Reverse complement sequence

CACAAATTTAAATGATAATTAGGATGGATGAAAACCAGTATTGCATATTGATATACTCATATTCTCATCATAATAAAGATGGGCATCGGTGCTCGGGCAA[C/T]
GAAGAAAACCAGAACAACAGGAACATGGCCGGCAACGACGTGGCCCTGATAGAGAGAGAAATGGCATTGGCGAGCTCTGGTGGTGAACACGAGCAGATGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.50%	34.80%	0.42%	0.28%	NA
All Indica	2759	97.70%	1.90%	0.07%	0.33%	NA
All Japonica	1512	2.90%	96.00%	0.99%	0.13%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.30%	0.50%	0.00%	0.17%	NA
Indica II	465	97.80%	1.90%	0.00%	0.22%	NA
Indica III	913	98.60%	1.00%	0.22%	0.22%	NA
Indica Intermediate	786	95.30%	4.10%	0.00%	0.64%	NA
Temperate Japonica	767	3.30%	95.00%	1.69%	0.00%	NA
Tropical Japonica	504	2.80%	96.80%	0.20%	0.20%	NA
Japonica Intermediate	241	2.10%	97.10%	0.41%	0.41%	NA
VI/Aromatic	96	1.00%	97.90%	1.04%	0.00%	NA
Intermediate	90	44.40%	51.10%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0212112209	G -> A	LOC_Os02g20530.1	downstream_gene_variant ; 1982.0bp to feature; MODIFIER	silent_mutation	Average:34.989; most accessible tissue: Zhenshan97 young leaf, score: 67.334	N	N	N	N
vg0212112209	G -> A	LOC_Os02g20540.1	downstream_gene_variant ; 1625.0bp to feature; MODIFIER	silent_mutation	Average:34.989; most accessible tissue: Zhenshan97 young leaf, score: 67.334	N	N	N	N
vg0212112209	G -> A	LOC_Os02g20540.2	downstream_gene_variant ; 1625.0bp to feature; MODIFIER	silent_mutation	Average:34.989; most accessible tissue: Zhenshan97 young leaf, score: 67.334	N	N	N	N
vg0212112209	G -> A	LOC_Os02g20530-LOC_Os02g20540	intergenic_region ; MODIFIER	silent_mutation	Average:34.989; most accessible tissue: Zhenshan97 young leaf, score: 67.334	N	N	N	N
vg0212112209	G -> DEL	N	N	silent_mutation	Average:34.989; most accessible tissue: Zhenshan97 young leaf, score: 67.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0212112209	NA	1.70E-69	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212112209	1.50E-06	1.50E-06	mr1717	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212112209	NA	3.04E-101	mr1987	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212112209	NA	1.22E-07	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212112209	NA	5.25E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212112209	NA	6.53E-18	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212112209	NA	2.20E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212112209	NA	7.94E-18	mr1336_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212112209	NA	8.77E-15	mr1686_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212112209	NA	7.97E-18	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251