Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0212084131:

Variant ID: vg0212084131 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 12084131
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAAAGTTTTTAAATTTGAGTTTAAAGTTTTCAAATATTGACTTGAAATTTTTCAAATAAAGATTTGAAAGTTTTAAAATAAGAGTTGAAAACTTTTAGA[T/C]
TTAAGTTGAAAGTATTAAAATCTTGGCTTGAAAATTTTGAAATCTAAGTTCAAATCTAGACTTGAAAGTTTTCAAATATTAGTTGAAAAGTTTCCAAATC

Reverse complement sequence

GATTTGGAAACTTTTCAACTAATATTTGAAAACTTTCAAGTCTAGATTTGAACTTAGATTTCAAAATTTTCAAGCCAAGATTTTAATACTTTCAACTTAA[A/G]
TCTAAAAGTTTTCAACTCTTATTTTAAAACTTTCAAATCTTTATTTGAAAAATTTCAAGTCAATATTTGAAAACTTTAAACTCAAATTTAAAAACTTTCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.30%	39.20%	0.49%	0.00%	NA
All Indica	2759	94.60%	4.50%	0.83%	0.00%	NA
All Japonica	1512	1.80%	98.20%	0.00%	0.00%	NA
Aus	269	64.30%	35.70%	0.00%	0.00%	NA
Indica I	595	98.30%	0.30%	1.34%	0.00%	NA
Indica II	465	96.30%	3.40%	0.22%	0.00%	NA
Indica III	913	93.60%	6.20%	0.11%	0.00%	NA
Indica Intermediate	786	92.00%	6.40%	1.65%	0.00%	NA
Temperate Japonica	767	1.00%	99.00%	0.00%	0.00%	NA
Tropical Japonica	504	2.80%	97.20%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	0.00%	100.00%	0.00%	0.00%	NA
Intermediate	90	45.60%	54.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0212084131	T -> C	LOC_Os02g20480.1	upstream_gene_variant ; 4173.0bp to feature; MODIFIER	silent_mutation	Average:33.158; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0212084131	T -> C	LOC_Os02g20490.1	upstream_gene_variant ; 1886.0bp to feature; MODIFIER	silent_mutation	Average:33.158; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0212084131	T -> C	LOC_Os02g20480-LOC_Os02g20490	intergenic_region ; MODIFIER	silent_mutation	Average:33.158; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0212084131	NA	1.45E-36	mr1064	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131	NA	1.41E-49	mr1125	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131	NA	1.89E-87	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131	NA	7.97E-40	mr1534	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131	NA	1.56E-71	mr1536	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131	NA	3.76E-72	mr1538	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131	NA	5.08E-42	mr1591	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131	NA	1.02E-33	mr1733	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131	NA	5.96E-52	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131	NA	2.76E-39	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131	NA	6.23E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131	NA	3.61E-57	mr1064_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131	NA	7.90E-62	mr1125_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131	NA	1.85E-34	mr1181_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131	NA	9.18E-13	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251