Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211790176:

Variant ID: vg0211790176 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 11790176
Reference Allele: T	Alternative Allele: C,G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

TTGCTTCGTTTAATTTGGATTCGAGCATGAATTGGTTCTTATCCCTTGTCCATCTTTAGATGTCAGTCCTATCCCTCGATTGCAAGCGCCGCTCCGAGCT[T/C,G]
CAGAGTCGCCGCCCTTAGCTTTATTGTCTTCCTAGTTTTGTTTGCCTGCTAGTTTCCGTGCATAGGTTTGTTGCTGGTGGATTAGTCGGCGGTCGATATC

Reverse complement sequence

GATATCGACCGCCGACTAATCCACCAGCAACAAACCTATGCACGGAAACTAGCAGGCAAACAAAACTAGGAAGACAATAAAGCTAAGGGCGGCGACTCTG[A/G,C]
AGCTCGGAGCGGCGCTTGCAATCGAGGGATAGGACTGACATCTAAAGATGGACAAGGGATAAGAACCAATTCATGCTCGAATCCAAATTAAACGAAGCAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.10%	0.40%	1.57%	3.83%	C: 0.13%
All Indica	2759	90.40%	0.50%	2.43%	6.42%	C: 0.22%
All Japonica	1512	99.90%	0.00%	0.07%	0.00%	NA
Aus	269	98.10%	0.70%	1.12%	0.00%	NA
Indica I	595	91.90%	0.00%	2.35%	5.21%	C: 0.50%
Indica II	465	84.50%	0.20%	3.66%	11.61%	NA
Indica III	913	91.80%	1.30%	1.42%	5.26%	C: 0.22%
Indica Intermediate	786	91.10%	0.30%	2.93%	5.60%	C: 0.13%
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	0.00%	3.33%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0211790176	T -> G	LOC_Os02g20020.1	upstream_gene_variant ; 260.0bp to feature; MODIFIER	silent_mutation	Average:16.742; most accessible tissue: Callus, score: 38.435	N	N	N	N
vg0211790176	T -> G	LOC_Os02g20010.1	downstream_gene_variant ; 4945.0bp to feature; MODIFIER	silent_mutation	Average:16.742; most accessible tissue: Callus, score: 38.435	N	N	N	N
vg0211790176	T -> G	LOC_Os02g20010-LOC_Os02g20020	intergenic_region ; MODIFIER	silent_mutation	Average:16.742; most accessible tissue: Callus, score: 38.435	N	N	N	N
vg0211790176	T -> DEL	N	N	silent_mutation	Average:16.742; most accessible tissue: Callus, score: 38.435	N	N	N	N
vg0211790176	T -> C	LOC_Os02g20020.1	upstream_gene_variant ; 260.0bp to feature; MODIFIER	silent_mutation	Average:16.742; most accessible tissue: Callus, score: 38.435	N	N	N	N
vg0211790176	T -> C	LOC_Os02g20010.1	downstream_gene_variant ; 4945.0bp to feature; MODIFIER	silent_mutation	Average:16.742; most accessible tissue: Callus, score: 38.435	N	N	N	N
vg0211790176	T -> C	LOC_Os02g20010-LOC_Os02g20020	intergenic_region ; MODIFIER	silent_mutation	Average:16.742; most accessible tissue: Callus, score: 38.435	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0211790176	2.44E-07	1.91E-07	mr1193	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211790176	6.50E-06	6.59E-06	mr1550	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211790176	1.44E-07	2.12E-08	mr1716	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211790176	4.80E-06	4.80E-06	mr1823	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251