Search for Variation information by Variation ID:
Detailed information for vg0211784990:
| Variant ID: vg0211784990 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 11784990 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 222. )
Flanking Sequence (100 bp) in Reference Genome:
CCACTTCTTTTTGTTCTAGGGGCTGAACTCTTGCAAAGAACAGTAAATAGGGCTTTCAATCTTGGATTAATTTCAAAGCCAATCAATGAAAATGATGGCA[G/C]
TGGGTTCCCCATCATCCAATATGCTGATGACACTTTGATCCTGCTAAAAGCTTCACAAAAGGAAATCTTTTGCTTCAAGGCACTACTAAATATGTTTGCT
Reverse complement sequence
AGCAAACATATTTAGTAGTGCCTTGAAGCAAAAGATTTCCTTTTGTGAAGCTTTTAGCAGGATCAAAGTGTCATCAGCATATTGGATGATGGGGAACCCA[C/G]
TGCCATCATTTTCATTGATTGGCTTTGAAATTAATCCAAGATTGAAAGCCCTATTTACTGTTCTTTGCAAGAGTTCAGCCCCTAGAACAAAAAGAAGTGG
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.50% | 16.80% | 3.36% | 30.39% | NA |
| All Indica | 2759 | 27.20% | 23.00% | 4.82% | 44.98% | NA |
| All Japonica | 1512 | 91.70% | 0.20% | 0.00% | 8.13% | NA |
| Aus | 269 | 28.60% | 55.00% | 9.29% | 7.06% | NA |
| Indica I | 595 | 12.30% | 19.70% | 5.04% | 63.03% | NA |
| Indica II | 465 | 18.10% | 34.40% | 4.52% | 43.01% | NA |
| Indica III | 913 | 41.20% | 20.20% | 4.16% | 34.50% | NA |
| Indica Intermediate | 786 | 27.70% | 22.00% | 5.60% | 44.66% | NA |
| Temperate Japonica | 767 | 91.30% | 0.10% | 0.00% | 8.60% | NA |
| Tropical Japonica | 504 | 93.70% | 0.20% | 0.00% | 6.15% | NA |
| Japonica Intermediate | 241 | 88.80% | 0.40% | 0.00% | 10.79% | NA |
| VI/Aromatic | 96 | 79.20% | 0.00% | 0.00% | 20.83% | NA |
| Intermediate | 90 | 53.30% | 8.90% | 1.11% | 36.67% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0211784990 | G -> DEL | LOC_Os02g20010.1 | N | frameshift_variant | Average:16.256; most accessible tissue: Callus, score: 52.259 | N | N | N | N |
| vg0211784990 | G -> C | LOC_Os02g20010.1 | missense_variant ; p.Ser947Thr; MODERATE | nonsynonymous_codon ; S947T | Average:16.256; most accessible tissue: Callus, score: 52.259 | benign  |
1.046 |
TOLERATED | 0.65 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0211784990 | NA | 4.05E-06 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211784990 | 4.17E-06 | 8.06E-07 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211784990 | 3.30E-06 | 1.51E-08 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211784990 | 6.86E-08 | 3.75E-13 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211784990 | 2.01E-07 | 3.99E-12 | mr1709 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211784990 | NA | 2.86E-06 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211784990 | NA | 2.55E-06 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211784990 | 6.90E-06 | 2.27E-14 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211784990 | NA | 2.38E-12 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |