Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211778484:

Variant ID: vg0211778484 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 11778484
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCACATGTAGCAGTACTTCTTCTCACAATTCGTTCGTCGCTGGTTAACACTAAACCGAGAAGCCTCTCGGTTTAGATTTTGCCTTATAGCAAACTATAAT[T/C]
GGTAGAAATTGATCAATTATCGTCATGTGCACCAAAGTTGCACATTTTCTCCAACAAAATACTATTTAGTCATGAACCAACACGTCTCCCTTGTAGGAAA

Reverse complement sequence

TTTCCTACAAGGGAGACGTGTTGGTTCATGACTAAATAGTATTTTGTTGGAGAAAATGTGCAACTTTGGTGCACATGACGATAATTGATCAATTTCTACC[A/G]
ATTATAGTTTGCTATAAGGCAAAATCTAAACCGAGAGGCTTCTCGGTTTAGTGTTAACCAGCGACGAACGAATTGTGAGAAGAAGTACTGCTACATGTGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.70%	4.00%	0.30%	58.95%	NA
All Indica	2759	3.60%	3.10%	0.40%	92.97%	NA
All Japonica	1512	98.20%	0.00%	0.00%	1.79%	NA
Aus	269	1.90%	38.30%	0.37%	59.48%	NA
Indica I	595	5.00%	0.00%	0.50%	94.45%	NA
Indica II	465	5.40%	0.60%	0.00%	93.98%	NA
Indica III	913	1.30%	4.90%	0.44%	93.32%	NA
Indica Intermediate	786	3.90%	4.70%	0.51%	90.84%	NA
Temperate Japonica	767	99.00%	0.00%	0.00%	1.04%	NA
Tropical Japonica	504	97.20%	0.00%	0.00%	2.78%	NA
Japonica Intermediate	241	97.90%	0.00%	0.00%	2.07%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	58.90%	1.10%	2.22%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0211778484	T -> DEL	N	N	silent_mutation	Average:23.297; most accessible tissue: Callus, score: 50.277	N	N	N	N
vg0211778484	T -> C	LOC_Os02g20010.1	upstream_gene_variant ; 742.0bp to feature; MODIFIER	silent_mutation	Average:23.297; most accessible tissue: Callus, score: 50.277	N	N	N	N
vg0211778484	T -> C	LOC_Os02g20000.1	downstream_gene_variant ; 542.0bp to feature; MODIFIER	silent_mutation	Average:23.297; most accessible tissue: Callus, score: 50.277	N	N	N	N
vg0211778484	T -> C	LOC_Os02g20000-LOC_Os02g20010	intergenic_region ; MODIFIER	silent_mutation	Average:23.297; most accessible tissue: Callus, score: 50.277	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0211778484	2.15E-08	9.46E-09	mr1275	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211778484	NA	3.58E-07	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211778484	NA	2.08E-09	mr1348	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211778484	6.26E-06	NA	mr1406	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211778484	NA	4.61E-07	mr1569	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211778484	NA	2.93E-09	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251