Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211208908:

Variant ID: vg0211208908 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 11208908
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

AGGTACTCCATCCGTCCCGTAAAAAAAAGTACCTATTACGGGATGTATCACATCCTAGTACATCGTAACACTATGAATCTAGATAAGAGCTACCTCTTCT[T/C]
CAGATTCGTAGTAACAGGAAATGTCACATTTCGTACTAGATTTATTTTTTATGAGACAAAGAGTAGTTCATTCATAAATAGTAGCGGATATAAGATGGAT

Reverse complement sequence

ATCCATCTTATATCCGCTACTATTTATGAATGAACTACTCTTTGTCTCATAAAAAATAAATCTAGTACGAAATGTGACATTTCCTGTTACTACGAATCTG[A/G]
AGAAGAGGTAGCTCTTATCTAGATTCATAGTGTTACGATGTACTAGGATGTGATACATCCCGTAATAGGTACTTTTTTTTACGGGACGGATGGAGTACCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.30%	31.90%	0.23%	1.61%	NA
All Indica	2759	95.90%	1.00%	0.36%	2.75%	NA
All Japonica	1512	10.60%	89.40%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.20%	2.20%	0.00%	0.65%	NA
Indica III	913	91.20%	0.70%	0.99%	7.12%	NA
Indica Intermediate	786	97.60%	1.30%	0.13%	1.02%	NA
Temperate Japonica	767	1.60%	98.40%	0.00%	0.00%	NA
Tropical Japonica	504	26.20%	73.80%	0.00%	0.00%	NA
Japonica Intermediate	241	6.60%	93.40%	0.00%	0.00%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	53.30%	45.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0211208908	T -> DEL	N	N	silent_mutation	Average:65.76; most accessible tissue: Callus, score: 81.214	N	N	N	N
vg0211208908	T -> C	LOC_Os02g19210.1	downstream_gene_variant ; 3027.0bp to feature; MODIFIER	silent_mutation	Average:65.76; most accessible tissue: Callus, score: 81.214	N	N	N	N
vg0211208908	T -> C	LOC_Os02g19220.1	downstream_gene_variant ; 128.0bp to feature; MODIFIER	silent_mutation	Average:65.76; most accessible tissue: Callus, score: 81.214	N	N	N	N
vg0211208908	T -> C	LOC_Os02g19210.2	downstream_gene_variant ; 3027.0bp to feature; MODIFIER	silent_mutation	Average:65.76; most accessible tissue: Callus, score: 81.214	N	N	N	N
vg0211208908	T -> C	LOC_Os02g19220.2	downstream_gene_variant ; 129.0bp to feature; MODIFIER	silent_mutation	Average:65.76; most accessible tissue: Callus, score: 81.214	N	N	N	N
vg0211208908	T -> C	LOC_Os02g19210-LOC_Os02g19220	intergenic_region ; MODIFIER	silent_mutation	Average:65.76; most accessible tissue: Callus, score: 81.214	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0211208908	NA	2.18E-12	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908	NA	5.56E-11	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908	NA	3.34E-26	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908	NA	2.97E-19	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908	NA	2.74E-13	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908	NA	3.01E-10	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908	2.73E-06	2.16E-09	mr1785_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908	NA	4.84E-10	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908	NA	2.58E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908	NA	5.12E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908	NA	2.75E-19	mr1874_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908	NA	8.44E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908	NA	3.33E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908	NA	6.56E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251