Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210666524:

Variant ID: vg0210666524 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 10666524
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


CCACCACCCTCCCCTCTCCGGCCCCCCAGCCGGATTTGGGAGGAGGGAGGGGAGCCTGCGCAGACACAACCCTGCTCCCTACCCCCTTCGGCCGGATCTA[G/A]
GTGGGAGGGGGCAACCACGCTGGGGTGGATGTAGCCACAGCCACCACCTTCCAGTCGCTCCCCTTCATCTAGATCTGGGAGGGAGGGGAGGGGAGCCGCG

Reverse complement sequence

CGCGGCTCCCCTCCCCTCCCTCCCAGATCTAGATGAAGGGGAGCGACTGGAAGGTGGTGGCTGTGGCTACATCCACCCCAGCGTGGTTGCCCCCTCCCAC[C/T]
TAGATCCGGCCGAAGGGGGTAGGGAGCAGGGTTGTGTCTGCGCAGGCTCCCCTCCCTCCTCCCAAATCCGGCTGGGGGGCCGGAGAGGGGAGGGTGGTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 16.50% 1.82% 0.53% NA
All Indica  2759 82.00% 16.10% 1.16% 0.69% NA
All Japonica  1512 87.40% 10.40% 2.18% 0.00% NA
Aus  269 51.30% 40.50% 6.32% 1.86% NA
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 75.30% 21.10% 3.01% 0.65% NA
Indica III  913 73.30% 24.90% 0.88% 0.99% NA
Indica Intermediate  786 83.00% 15.10% 1.02% 0.89% NA
Temperate Japonica  767 98.00% 1.00% 0.91% 0.00% NA
Tropical Japonica  504 78.60% 19.20% 2.18% 0.00% NA
Japonica Intermediate  241 72.20% 21.60% 6.22% 0.00% NA
VI/Aromatic  96 43.80% 54.20% 1.04% 1.04% NA
Intermediate  90 80.00% 16.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0210666524 G -> A LOC_Os02g18340.1 downstream_gene_variant ; 3453.0bp to feature; MODIFIER silent_mutation Average:81.383; most accessible tissue: Zhenshan97 young leaf, score: 89.559 N N N N
vg0210666524 G -> A LOC_Os02g18340-LOC_Os02g18350 intergenic_region ; MODIFIER silent_mutation Average:81.383; most accessible tissue: Zhenshan97 young leaf, score: 89.559 N N N N
vg0210666524 G -> DEL N N silent_mutation Average:81.383; most accessible tissue: Zhenshan97 young leaf, score: 89.559 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0210666524 G A -0.03 -0.03 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0210666524 NA 5.93E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210666524 NA 5.23E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210666524 NA 3.26E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210666524 NA 3.94E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210666524 NA 4.82E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210666524 NA 2.30E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210666524 NA 2.51E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210666524 7.90E-07 1.24E-07 mr1118_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210666524 NA 1.85E-07 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210666524 NA 1.44E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210666524 6.89E-06 2.36E-08 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251