Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210071634:

Variant ID: vg0210071634 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 10071634
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGGATTGTTATCAACATGTGAGTGTCTTTCCAGCCAGTCGAGGATGTAGTAGTGGCCAAGGACGGCGGGCGGACAGGCATTAGCGATGAGGCAGCAGAA[G/A]
CGCGTGCAGGCGAAGGTGACGAGGTGATGAAGCGGAGGAGGACGCACTATAGGAGGTCATCGATGTCGGTAGGAGTATCTTTTGGCTTCCATGCTTTTTC

Reverse complement sequence

GAAAAAGCATGGAAGCCAAAAGATACTCCTACCGACATCGATGACCTCCTATAGTGCGTCCTCCTCCGCTTCATCACCTCGTCACCTTCGCCTGCACGCG[C/T]
TTCTGCTGCCTCATCGCTAATGCCTGTCCGCCCGCCGTCCTTGGCCACTACTACATCCTCGACTGGCTGGAAAGACACTCACATGTTGATAACAATCCGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 8.90% 0.00% 0.00% NA
All Indica  2759 91.20% 8.80% 0.00% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 40.50% 59.50% 0.00% 0.00% NA
Indica I  595 87.20% 12.80% 0.00% 0.00% NA
Indica II  465 95.70% 4.30% 0.00% 0.00% NA
Indica III  913 94.00% 6.00% 0.00% 0.00% NA
Indica Intermediate  786 88.40% 11.60% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0210071634 G -> A LOC_Os02g17480.1 upstream_gene_variant ; 4186.0bp to feature; MODIFIER silent_mutation Average:74.397; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 N N N N
vg0210071634 G -> A LOC_Os02g17500.1 upstream_gene_variant ; 2947.0bp to feature; MODIFIER silent_mutation Average:74.397; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 N N N N
vg0210071634 G -> A LOC_Os02g17500.3 upstream_gene_variant ; 2947.0bp to feature; MODIFIER silent_mutation Average:74.397; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 N N N N
vg0210071634 G -> A LOC_Os02g17500.2 upstream_gene_variant ; 3379.0bp to feature; MODIFIER silent_mutation Average:74.397; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 N N N N
vg0210071634 G -> A LOC_Os02g17490.1 downstream_gene_variant ; 525.0bp to feature; MODIFIER silent_mutation Average:74.397; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 N N N N
vg0210071634 G -> A LOC_Os02g17490-LOC_Os02g17500 intergenic_region ; MODIFIER silent_mutation Average:74.397; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0210071634 NA 1.76E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210071634 NA 7.22E-06 mr1186 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210071634 NA 1.22E-06 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210071634 NA 1.09E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210071634 NA 8.71E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210071634 NA 1.33E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210071634 NA 6.93E-08 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210071634 2.82E-06 2.82E-06 mr1863 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251