Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209688142:

Variant ID: vg0209688142 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 9688142
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACCGATTTGTGACCGGTCTGACACTGGTCATATCGTCAGCAGAAAGCCATATTCCCACGTCGCGCCTGCTTCCGGCGGAAGTGGAGGTAGGTATGGGCC[G/A]
TCCCATCAGAAGGTCATTCAGACGGCAACCATACAAATCTCCGTCCATTTATGAAAAGATAGGATAAGTCCCCACACAAAAGAGAGAGATGGTGCATGTG

Reverse complement sequence

CACATGCACCATCTCTCTCTTTTGTGTGGGGACTTATCCTATCTTTTCATAAATGGACGGAGATTTGTATGGTTGCCGTCTGAATGACCTTCTGATGGGA[C/T]
GGCCCATACCTACCTCCACTTCCGCCGGAAGCAGGCGCGACGTGGGAATATGGCTTTCTGCTGACGATATGACCAGTGTCAGACCGGTCACAAATCGGTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.80%	0.50%	2.16%	23.53%	NA
All Indica	2759	63.80%	0.00%	3.04%	33.09%	NA
All Japonica	1512	95.00%	1.50%	0.07%	3.37%	NA
Aus	269	48.70%	0.00%	5.58%	45.72%	NA
Indica I	595	70.40%	0.20%	0.67%	28.74%	NA
Indica II	465	56.60%	0.00%	5.59%	37.85%	NA
Indica III	913	63.60%	0.00%	3.50%	32.86%	NA
Indica Intermediate	786	63.40%	0.00%	2.80%	33.84%	NA
Temperate Japonica	767	91.40%	2.50%	0.13%	6.00%	NA
Tropical Japonica	504	99.20%	0.00%	0.00%	0.79%	NA
Japonica Intermediate	241	97.90%	1.70%	0.00%	0.41%	NA
VI/Aromatic	96	91.70%	0.00%	1.04%	7.29%	NA
Intermediate	90	78.90%	0.00%	1.11%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0209688142	G -> A	LOC_Os02g16980.1	upstream_gene_variant ; 3700.0bp to feature; MODIFIER	silent_mutation	Average:14.762; most accessible tissue: Zhenshan97 flag leaf, score: 40.929	N	N	N	N
vg0209688142	G -> A	LOC_Os02g16970.1	downstream_gene_variant ; 968.0bp to feature; MODIFIER	silent_mutation	Average:14.762; most accessible tissue: Zhenshan97 flag leaf, score: 40.929	N	N	N	N
vg0209688142	G -> A	LOC_Os02g16970-LOC_Os02g16980	intergenic_region ; MODIFIER	silent_mutation	Average:14.762; most accessible tissue: Zhenshan97 flag leaf, score: 40.929	N	N	N	N
vg0209688142	G -> DEL	N	N	silent_mutation	Average:14.762; most accessible tissue: Zhenshan97 flag leaf, score: 40.929	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0209688142	1.13E-08	5.90E-11	mr1549	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209688142	3.40E-08	4.60E-09	mr1550	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209688142	4.62E-06	7.60E-10	mr1757	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209688142	6.85E-06	6.85E-06	mr1881	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209688142	NA	3.06E-06	mr1896	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209688142	NA	1.99E-07	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251