Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208829098:

Variant ID: vg0208829098 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8829098
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.24, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGCCGAGACCCAATAACTTAAGGTTGCTCGGACCCCAACAGTTCTTTGGCATAAGCCCGATCTCCCTAAAAGACTAGTCCAATAGGGGAAGAGTGGCT[T/C]
GCTAAGCAAGGTGAGATTATTTAGAGGCTCACACGGTCGCCGCCCGACTTTAGCGTCTTTGCCAGCGGGTAATAGTGGAGGATGTCCTCATCAGATACCA

Reverse complement sequence

TGGTATCTGATGAGGACATCCTCCACTATTACCCGCTGGCAAAGACGCTAAAGTCGGGCGGCGACCGTGTGAGCCTCTAAATAATCTCACCTTGCTTAGC[A/G]
AGCCACTCTTCCCCTATTGGACTAGTCTTTTAGGGAGATCGGGCTTATGCCAAAGAACTGTTGGGGTCCGAGCAACCTTAAGTTATTGGGTCTCGGCCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.00% 30.60% 10.18% 13.18% NA
All Indica  2759 30.70% 31.90% 16.67% 20.66% NA
All Japonica  1512 63.40% 35.10% 0.79% 0.66% NA
Aus  269 83.60% 4.50% 0.00% 11.90% NA
Indica I  595 17.50% 22.50% 38.32% 21.68% NA
Indica II  465 29.00% 36.10% 12.26% 22.58% NA
Indica III  913 39.20% 37.80% 5.04% 17.96% NA
Indica Intermediate  786 31.90% 29.80% 16.41% 21.88% NA
Temperate Japonica  767 37.30% 61.40% 0.78% 0.52% NA
Tropical Japonica  504 94.00% 4.40% 0.40% 1.19% NA
Japonica Intermediate  241 82.60% 15.80% 1.66% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 54.40% 23.30% 10.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208829098 T -> DEL N N silent_mutation Average:46.598; most accessible tissue: Zhenshan97 panicle, score: 92.784 N N N N
vg0208829098 T -> C LOC_Os02g15690.1 upstream_gene_variant ; 4925.0bp to feature; MODIFIER silent_mutation Average:46.598; most accessible tissue: Zhenshan97 panicle, score: 92.784 N N N N
vg0208829098 T -> C LOC_Os02g15670.1 downstream_gene_variant ; 3718.0bp to feature; MODIFIER silent_mutation Average:46.598; most accessible tissue: Zhenshan97 panicle, score: 92.784 N N N N
vg0208829098 T -> C LOC_Os02g15680.1 downstream_gene_variant ; 21.0bp to feature; MODIFIER silent_mutation Average:46.598; most accessible tissue: Zhenshan97 panicle, score: 92.784 N N N N
vg0208829098 T -> C LOC_Os02g15670-LOC_Os02g15680 intergenic_region ; MODIFIER silent_mutation Average:46.598; most accessible tissue: Zhenshan97 panicle, score: 92.784 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0208829098 T C -0.02 -0.01 0.0 0.02 -0.03 -0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208829098 NA 2.83E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208829098 4.27E-06 NA mr1925 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208829098 6.19E-06 NA mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208829098 NA 6.88E-07 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251