Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208721652:

Variant ID: vg0208721652 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8721652
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


AGCAACAAGTGTCCGTCAAATAGTACTCACTCCGTCCCATTTGATACTCCCTCCATCTATTTTTGATAGGCATATTTACAAATCTGAAAAATTTATTTTT[G/A]
AGAGGCATATTTCAATCCAACAATCTGACTTTTTCGGATTTAATGCGTGACTCACCATTCTTCCACACAAGATTGGCTACTTGGGCATCGGGAAATGTAA

Reverse complement sequence

TTACATTTCCCGATGCCCAAGTAGCCAATCTTGTGTGGAAGAATGGTGAGTCACGCATTAAATCCGAAAAAGTCAGATTGTTGGATTGAAATATGCCTCT[C/T]
AAAAATAAATTTTTCAGATTTGTAAATATGCCTATCAAAAATAGATGGAGGGAGTATCAAATGGGACGGAGTGAGTACTATTTGACGGACACTTGTTGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 18.30% 0.51% 0.00% NA
All Indica  2759 75.50% 24.30% 0.22% 0.00% NA
All Japonica  1512 89.10% 9.90% 1.06% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.60% 2.40% 0.00% 0.00% NA
Indica II  465 93.50% 6.50% 0.00% 0.00% NA
Indica III  913 52.80% 46.90% 0.33% 0.00% NA
Indica Intermediate  786 74.30% 25.30% 0.38% 0.00% NA
Temperate Japonica  767 89.60% 8.60% 1.83% 0.00% NA
Tropical Japonica  504 88.30% 11.30% 0.40% 0.00% NA
Japonica Intermediate  241 89.20% 10.80% 0.00% 0.00% NA
VI/Aromatic  96 64.60% 35.40% 0.00% 0.00% NA
Intermediate  90 86.70% 11.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208721652 G -> A LOC_Os02g15550.2 downstream_gene_variant ; 4960.0bp to feature; MODIFIER silent_mutation Average:78.907; most accessible tissue: Zhenshan97 young leaf, score: 96.13 N N N N
vg0208721652 G -> A LOC_Os02g15550.1 downstream_gene_variant ; 4960.0bp to feature; MODIFIER silent_mutation Average:78.907; most accessible tissue: Zhenshan97 young leaf, score: 96.13 N N N N
vg0208721652 G -> A LOC_Os02g15550.3 downstream_gene_variant ; 4960.0bp to feature; MODIFIER silent_mutation Average:78.907; most accessible tissue: Zhenshan97 young leaf, score: 96.13 N N N N
vg0208721652 G -> A LOC_Os02g15540-LOC_Os02g15550 intergenic_region ; MODIFIER silent_mutation Average:78.907; most accessible tissue: Zhenshan97 young leaf, score: 96.13 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0208721652 G A -0.01 -0.08 -0.05 0.0 -0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208721652 3.91E-06 3.07E-06 mr1359 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208721652 3.81E-07 3.18E-07 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208721652 8.90E-06 NA mr1546 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208721652 6.86E-06 NA mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208721652 3.56E-06 NA mr1874 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251