Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208609024:

Variant ID: vg0208609024 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8609024
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.03, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:

GGCGCATGCAGGTGTCACGCGATGTCATCTTCGACGAAGGCGCGAGCTGGGACTGGGGCGCTAAAGTGACCGAGTCTGGCCTTGAACAGACGGAGTTTTC[C/A]
GTCGAGTATGTGCTGACACAGGTGAGCGGTGGTGGTCGCGGCGCTCAGGAGGAAAACTCATCGTCAAGCTCACGACGCGCTGCATCGACCATGCCTGAGG

Reverse complement sequence

CCTCAGGCATGGTCGATGCAGCGCGTCGTGAGCTTGACGATGAGTTTTCCTCCTGAGCGCCGCGACCACCACCGCTCACCTGTGTCAGCACATACTCGAC[G/T]
GAAAACTCCGTCTGTTCAAGGCCAGACTCGGTCACTTTAGCGCCCCAGTCCCAGCTCGCGCCTTCGTCGAAGATGACATCGCGTGACACCTGCATGCGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.50%	8.30%	1.14%	54.06%	NA
All Indica	2759	21.80%	13.60%	1.59%	62.99%	NA
All Japonica	1512	57.30%	0.20%	0.40%	42.06%	NA
Aus	269	72.10%	0.40%	1.12%	26.39%	NA
Indica I	595	22.70%	8.70%	1.51%	67.06%	NA
Indica II	465	17.80%	24.30%	2.58%	55.27%	NA
Indica III	913	19.30%	13.10%	0.88%	66.70%	NA
Indica Intermediate	786	26.30%	11.60%	1.91%	60.18%	NA
Temperate Japonica	767	81.70%	0.00%	0.26%	17.99%	NA
Tropical Japonica	504	30.40%	0.40%	0.60%	68.65%	NA
Japonica Intermediate	241	36.10%	0.40%	0.41%	63.07%	NA
VI/Aromatic	96	24.00%	1.00%	1.04%	73.96%	NA
Intermediate	90	42.20%	14.40%	0.00%	43.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208609024	C -> A	LOC_Os02g15380.1	upstream_gene_variant ; 3101.0bp to feature; MODIFIER	silent_mutation	Average:11.92; most accessible tissue: Callus, score: 49.554	N	N	N	N
vg0208609024	C -> A	LOC_Os02g15390.1	upstream_gene_variant ; 846.0bp to feature; MODIFIER	silent_mutation	Average:11.92; most accessible tissue: Callus, score: 49.554	N	N	N	N
vg0208609024	C -> A	LOC_Os02g15400.1	upstream_gene_variant ; 541.0bp to feature; MODIFIER	silent_mutation	Average:11.92; most accessible tissue: Callus, score: 49.554	N	N	N	N
vg0208609024	C -> A	LOC_Os02g15410.1	downstream_gene_variant ; 3335.0bp to feature; MODIFIER	silent_mutation	Average:11.92; most accessible tissue: Callus, score: 49.554	N	N	N	N
vg0208609024	C -> A	LOC_Os02g15390-LOC_Os02g15400	intergenic_region ; MODIFIER	silent_mutation	Average:11.92; most accessible tissue: Callus, score: 49.554	N	N	N	N
vg0208609024	C -> DEL	N	N	silent_mutation	Average:11.92; most accessible tissue: Callus, score: 49.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208609024	8.78E-06	8.78E-06	mr1160	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208609024	5.09E-06	1.02E-10	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208609024	1.48E-06	NA	mr1326	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208609024	NA	6.55E-06	mr1326	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208609024	NA	6.21E-08	mr1527	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208609024	7.25E-06	7.25E-06	mr1527	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208609024	NA	3.90E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208609024	NA	1.32E-06	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251