Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208594952:

Variant ID: vg0208594952 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8594952
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCATCCACACAACGGGGACGTGGGACTGAGGCGGTGCCGCTCTTCCATTCCACAGGACCGGCGGTCGCACAGGACGGCCGTGCGGCACCGCCTCACTCA[C/T]
GCAGCCCGGGAGAGCGGCAGCGCGGTGCAGGGCGGTCCTGCGTGCGACTGGCACGGGTGCCGCACGACGGCGCTATGCGACTGCTATGGTCCCGCGCCAC

Reverse complement sequence

GTGGCGCGGGACCATAGCAGTCGCATAGCGCCGTCGTGCGGCACCCGTGCCAGTCGCACGCAGGACCGCCCTGCACCGCGCTGCCGCTCTCCCGGGCTGC[G/A]
TGAGTGAGGCGGTGCCGCACGGCCGTCCTGTGCGACCGCCGGTCCTGTGGAATGGAAGAGCGGCACCGCCTCAGTCCCACGTCCCCGTTGTGTGGATGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.30% 14.60% 0.13% 0.00% NA
All Indica  2759 78.70% 21.10% 0.18% 0.00% NA
All Japonica  1512 98.80% 1.20% 0.00% 0.00% NA
Aus  269 71.70% 27.90% 0.37% 0.00% NA
Indica I  595 72.80% 26.90% 0.34% 0.00% NA
Indica II  465 64.30% 35.50% 0.22% 0.00% NA
Indica III  913 87.30% 12.70% 0.00% 0.00% NA
Indica Intermediate  786 81.70% 18.10% 0.25% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 97.60% 2.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208594952 C -> T LOC_Os02g15350.1 upstream_gene_variant ; 1027.0bp to feature; MODIFIER silent_mutation Average:78.004; most accessible tissue: Zhenshan97 panicle, score: 95.016 N N N N
vg0208594952 C -> T LOC_Os02g15360.1 downstream_gene_variant ; 2215.0bp to feature; MODIFIER silent_mutation Average:78.004; most accessible tissue: Zhenshan97 panicle, score: 95.016 N N N N
vg0208594952 C -> T LOC_Os02g15350-LOC_Os02g15360 intergenic_region ; MODIFIER silent_mutation Average:78.004; most accessible tissue: Zhenshan97 panicle, score: 95.016 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0208594952 C T -0.01 0.0 0.0 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208594952 NA 8.34E-06 mr1293 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208594952 NA 6.30E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208594952 NA 2.01E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208594952 NA 5.34E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208594952 NA 2.88E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208594952 2.02E-06 8.18E-09 mr1884 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251