Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208321255:

Variant ID: vg0208321255 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8321255
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTGTGGCGTCCATCCTGGCCCCTCGACGGTGGCGACTCTTGTGAATTTGATTGGGGGAATCGATGGTGGCCTAGATGTGATGGGGGAGCGGCTCGCCAA[C/T]
GCATCGAGCAAGCTTTTTTTTTTTTGCATTCGTGCAACATTAAAGGTATTGGTTCCTAAATCAATACCTTTGATTCCTCCTGTGAGGTGTCGGTTGGAAA

Reverse complement sequence

TTTCCAACCGACACCTCACAGGAGGAATCAAAGGTATTGATTTAGGAACCAATACCTTTAATGTTGCACGAATGCAAAAAAAAAAAAGCTTGCTCGATGC[G/A]
TTGGCGAGCCGCTCCCCCATCACATCTAGGCCACCATCGATTCCCCCAATCAAATTCACAAGAGTCGCCACCGTCGAGGGGCCAGGATGGACGCCACAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.00%	26.90%	1.44%	0.70%	NA
All Indica	2759	94.20%	2.90%	1.78%	1.16%	NA
All Japonica	1512	22.80%	76.10%	1.12%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	93.10%	1.80%	5.04%	0.00%	NA
Indica II	465	97.00%	1.70%	0.65%	0.65%	NA
Indica III	913	96.80%	0.70%	0.44%	2.08%	NA
Indica Intermediate	786	90.20%	7.00%	1.53%	1.27%	NA
Temperate Japonica	767	4.40%	95.40%	0.13%	0.00%	NA
Tropical Japonica	504	56.50%	41.10%	2.38%	0.00%	NA
Japonica Intermediate	241	10.80%	87.60%	1.66%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	67.80%	28.90%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208321255	C -> T	LOC_Os02g14910.1	upstream_gene_variant ; 2636.0bp to feature; MODIFIER	silent_mutation	Average:70.482; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg0208321255	C -> T	LOC_Os02g14900.1	downstream_gene_variant ; 4064.0bp to feature; MODIFIER	silent_mutation	Average:70.482; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg0208321255	C -> T	LOC_Os02g14929.1	downstream_gene_variant ; 4828.0bp to feature; MODIFIER	silent_mutation	Average:70.482; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg0208321255	C -> T	LOC_Os02g14900-LOC_Os02g14910	intergenic_region ; MODIFIER	silent_mutation	Average:70.482; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg0208321255	C -> DEL	N	N	silent_mutation	Average:70.482; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208321255	NA	2.07E-08	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208321255	NA	8.82E-09	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208321255	7.00E-07	NA	mr1174_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208321255	3.08E-06	1.60E-07	mr1174_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208321255	NA	7.97E-07	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208321255	NA	5.77E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208321255	NA	3.51E-11	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208321255	NA	1.95E-07	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208321255	NA	1.39E-07	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251