Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208268939:

Variant ID: vg0208268939 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8268939
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGTAGCACCTCTCTCGCCGGAGAGTCCACTGGCCTCTCCGGTCATTGAATCTCCGGTAGGCGGCGGCGTTGGTTAGATCATCCACCCATCTAGATTTC[A/T]
AGTCTTTGCCGATGAACTCTATGATTATGGGGGTTGACGAAAGATGCCCAAGATACCAGTGCTGGTTGACATACTTTTTGCATCTGAACAACGCCGCTAT

Reverse complement sequence

ATAGCGGCGTTGTTCAGATGCAAAAAGTATGTCAACCAGCACTGGTATCTTGGGCATCTTTCGTCAACCCCCATAATCATAGAGTTCATCGGCAAAGACT[T/A]
GAAATCTAGATGGGTGGATGATCTAACCAACGCCGCCGCCTACCGGAGATTCAATGACCGGAGAGGCCAGTGGACTCTCCGGCGAGAGAGGTGCTACCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 15.40% 0.78% 20.84% NA
All Indica  2759 52.80% 25.50% 0.40% 21.28% NA
All Japonica  1512 74.00% 0.90% 1.65% 23.48% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 56.00% 5.70% 1.01% 37.31% NA
Indica II  465 41.10% 52.00% 0.00% 6.88% NA
Indica III  913 56.50% 25.70% 0.11% 17.63% NA
Indica Intermediate  786 53.20% 24.40% 0.51% 21.88% NA
Temperate Japonica  767 95.60% 0.70% 0.00% 3.78% NA
Tropical Japonica  504 42.50% 0.80% 4.17% 52.58% NA
Japonica Intermediate  241 71.40% 1.70% 1.66% 25.31% NA
VI/Aromatic  96 66.70% 1.00% 1.04% 31.25% NA
Intermediate  90 73.30% 13.30% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208268939 A -> T LOC_Os02g14870.1 stop_gained ; p.Leu397*; HIGH stop_gained Average:51.338; most accessible tissue: Minghui63 flag leaf, score: 89.997 N N N N
vg0208268939 A -> DEL LOC_Os02g14870.1 N frameshift_variant Average:51.338; most accessible tissue: Minghui63 flag leaf, score: 89.997 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0208268939 A T 0.0 -0.01 -0.01 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208268939 9.17E-06 NA mr1275 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208268939 9.83E-06 9.53E-06 mr1293 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208268939 7.91E-06 4.29E-09 mr1319 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208268939 NA 3.22E-07 mr1319 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208268939 8.64E-08 NA mr1323 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208268939 4.70E-07 4.70E-07 mr1323 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208268939 9.19E-06 NA mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208268939 1.46E-06 5.11E-06 mr1363 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208268939 7.40E-07 NA mr1363 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208268939 4.32E-06 2.85E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208268939 8.51E-06 NA mr1428 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208268939 NA 6.73E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208268939 6.50E-06 NA mr1964 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251