Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208267128:

Variant ID: vg0208267128 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8267128
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

GCTGCCATCGCCACCAATCCAAATTCTCGCACCGTCGCAAGGTAGCCACCTCATCCTTCCTTATCCTCTTCCCTCTCTCCACATGCTGCCGTCGCCGCTC[C/T]
AGCGCCCGTCCGCCTCTCCAACCCCCACCTGCCACCGCCACCACTACCGATCTGGCCCCTGCTCCCCGCGCACGTCAAAGGGGAGGAGAAATACGGAAAG

Reverse complement sequence

CTTTCCGTATTTCTCCTCCCCTTTGACGTGCGCGGGGAGCAGGGGCCAGATCGGTAGTGGTGGCGGTGGCAGGTGGGGGTTGGAGAGGCGGACGGGCGCT[G/A]
GAGCGGCGACGGCAGCATGTGGAGAGAGGGAAGAGGATAAGGAAGGATGAGGTGGCTACCTTGCGACGGTGCGAGAATTTGGATTGGTGGCGATGGCAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.40%	5.70%	0.55%	21.35%	NA
All Indica	2759	68.80%	9.20%	0.80%	21.20%	NA
All Japonica	1512	74.10%	0.50%	0.20%	25.13%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	49.90%	10.90%	1.85%	37.31%	NA
Indica II	465	69.20%	23.40%	0.43%	6.88%	NA
Indica III	913	81.70%	0.40%	0.11%	17.74%	NA
Indica Intermediate	786	67.70%	9.80%	1.02%	21.50%	NA
Temperate Japonica	767	95.80%	0.50%	0.00%	3.65%	NA
Tropical Japonica	504	42.30%	0.20%	0.40%	57.14%	NA
Japonica Intermediate	241	71.80%	1.20%	0.41%	26.56%	NA
VI/Aromatic	96	66.70%	0.00%	1.04%	32.29%	NA
Intermediate	90	80.00%	6.70%	0.00%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208267128	C -> T	LOC_Os02g14860.1	downstream_gene_variant ; 1405.0bp to feature; MODIFIER	silent_mutation	Average:49.673; most accessible tissue: Minghui63 panicle, score: 89.175	N	N	N	N
vg0208267128	C -> T	LOC_Os02g14870.1	downstream_gene_variant ; 1105.0bp to feature; MODIFIER	silent_mutation	Average:49.673; most accessible tissue: Minghui63 panicle, score: 89.175	N	N	N	N
vg0208267128	C -> T	LOC_Os02g14860-LOC_Os02g14870	intergenic_region ; MODIFIER	silent_mutation	Average:49.673; most accessible tissue: Minghui63 panicle, score: 89.175	N	N	N	N
vg0208267128	C -> DEL	N	N	silent_mutation	Average:49.673; most accessible tissue: Minghui63 panicle, score: 89.175	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208267128	3.68E-06	3.68E-06	mr1054	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267128	5.41E-06	5.41E-06	mr1287	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267128	8.82E-06	8.82E-06	mr1573	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267128	7.68E-06	7.68E-06	mr1762	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267128	8.60E-07	6.74E-07	mr1906	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267128	NA	2.06E-06	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267128	NA	2.59E-06	mr1921	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267128	NA	8.33E-08	mr1982	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251