Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208262087:

Variant ID: vg0208262087 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8262087
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTCCAGCCCCGCGCGCATCCGCTCGGCTTGCACGGCATCCACCAAACACCGACGCCGATCAAACACCACTCACCAAACACAAACAGAGGAGGCCGGCGG[C/T]
GTGAGCGGGTGCGTGGCCTCGTTGTAGGTGAAGAAGAGCGAGGCGTTGGCTGTCGGGATGGGAGGCCTGTTCCAGCGTCGCCTGTCGCCAGCCTAGAGAG

Reverse complement sequence

CTCTCTAGGCTGGCGACAGGCGACGCTGGAACAGGCCTCCCATCCCGACAGCCAACGCCTCGCTCTTCTTCACCTACAACGAGGCCACGCACCCGCTCAC[G/A]
CCGCCGGCCTCCTCTGTTTGTGTTTGGTGAGTGGTGTTTGATCGGCGTCGGTGTTTGGTGGATGCCGTGCAAGCCGAGCGGATGCGCGCGGGGCTGGAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.30% 4.20% 0.66% 19.81% NA
All Indica  2759 73.00% 6.80% 1.01% 19.21% NA
All Japonica  1512 74.90% 0.50% 0.13% 24.40% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 59.20% 5.40% 0.67% 34.79% NA
Indica II  465 69.90% 22.80% 0.43% 6.88% NA
Indica III  913 84.20% 0.10% 1.42% 14.24% NA
Indica Intermediate  786 72.30% 6.10% 1.15% 20.48% NA
Temperate Japonica  767 96.00% 0.50% 0.00% 3.52% NA
Tropical Japonica  504 44.20% 0.20% 0.40% 55.16% NA
Japonica Intermediate  241 72.20% 1.20% 0.00% 26.56% NA
VI/Aromatic  96 72.90% 0.00% 1.04% 26.04% NA
Intermediate  90 82.20% 5.60% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208262087 C -> T LOC_Os02g14855.1 5_prime_UTR_variant ; 335.0bp to feature; MODIFIER silent_mutation Average:59.165; most accessible tissue: Minghui63 panicle, score: 95.151 N N N N
vg0208262087 C -> T LOC_Os02g14860.1 upstream_gene_variant ; 459.0bp to feature; MODIFIER silent_mutation Average:59.165; most accessible tissue: Minghui63 panicle, score: 95.151 N N N N
vg0208262087 C -> T LOC_Os02g14850.1 downstream_gene_variant ; 4517.0bp to feature; MODIFIER silent_mutation Average:59.165; most accessible tissue: Minghui63 panicle, score: 95.151 N N N N
vg0208262087 C -> DEL N N silent_mutation Average:59.165; most accessible tissue: Minghui63 panicle, score: 95.151 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0208262087 C T -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208262087 NA 8.47E-06 mr1036 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208262087 NA 7.36E-06 mr1510 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208262087 2.31E-06 1.75E-06 mr1762 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208262087 2.13E-06 2.13E-06 mr1762 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251