Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208229343:

Variant ID: vg0208229343 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8229343
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGCGATAGTGTGCTTTATTTGTGGTTCTAGCTTGCACACCGGCCACTTATGGTAGCGCAGCGAAATCATGTTACTGAATTCCACTACGAATTCAGAGTA[T/C]
AGAAGGATGTAGGTTACCTTGACATCGTTGGCGTCGAGCCCGTCTATGTTGCTGTCAAGCCCGTCAAAGCCTCCGATGGCCGTGGAGGCCAGCATGAAAA

Reverse complement sequence

TTTTCATGCTGGCCTCCACGGCCATCGGAGGCTTTGACGGGCTTGACAGCAACATAGACGGGCTCGACGCCAACGATGTCAAGGTAACCTACATCCTTCT[A/G]
TACTCTGAATTCGTAGTGGAATTCAGTAACATGATTTCGCTGCGCTACCATAAGTGGCCGGTGTGCAAGCTAGAACCACAAATAAAGCACACTATCGCGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.60% 0.20% 1.12% 31.08% NA
All Indica  2759 60.10% 0.20% 0.87% 38.85% NA
All Japonica  1512 84.90% 0.00% 1.12% 14.02% NA
Aus  269 53.50% 0.00% 2.97% 43.49% NA
Indica I  595 71.60% 0.20% 0.34% 27.90% NA
Indica II  465 64.30% 0.00% 1.29% 34.41% NA
Indica III  913 48.10% 0.20% 0.77% 50.93% NA
Indica Intermediate  786 62.70% 0.40% 1.15% 35.75% NA
Temperate Japonica  767 98.20% 0.00% 0.13% 1.69% NA
Tropical Japonica  504 64.30% 0.00% 2.78% 32.94% NA
Japonica Intermediate  241 85.50% 0.00% 0.83% 13.69% NA
VI/Aromatic  96 47.90% 1.00% 3.12% 47.92% NA
Intermediate  90 73.30% 1.10% 1.11% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208229343 T -> DEL LOC_Os02g14810.1 N frameshift_variant Average:74.19; most accessible tissue: Zhenshan97 flower, score: 86.702 N N N N
vg0208229343 T -> C LOC_Os02g14810.1 synonymous_variant ; p.Leu342Leu; LOW synonymous_codon Average:74.19; most accessible tissue: Zhenshan97 flower, score: 86.702 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0208229343 T C 0.01 -0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208229343 2.70E-07 3.69E-06 mr1004 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208229343 4.84E-08 1.33E-06 mr1005 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251